Genomic Feature

hg14

ID
ZDB-ALT-140415-3
Name
hg14
Synonyms
  • del2 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Sood Lab
Current Source
Other Pages
Notes
Comment Citation
more likely fully null allele Rissone et al., 2019
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 19: 35428769 - 35428770 (GRCz11) (1) Details
Nucleotide change
TT/-
Variant Notes
Deletion of 2 bps in exon1, cDNA: 45delAA, p:K16RfsX62
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted at position 45 in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
CGTACAGAACTGGAAATAAATACAATGTGTAACGTTACATGACGACAGAACTTGACGTTAACGTTACATATCATAACTGACATTACTGAGTGAGCTAACGTGTCATTCCCAGGAAAACAGTGAGGTAAATTTGGTTTTATATTCACACATTTAGACTTTAAAATATACTTTCTGAATGTATCAATTGCAAATTCTAAATAGTAAAATCATATTAACATTGTATTTGACTATCAAAGCACAACAATGTTCAGTCAGTAAAATAAGGCTAATGTTGTTTTGAAGTCATACTTGCATATGATTTCAGACCGAATATTCAAAGTAACATTACTATGGTAAACACTGTATAGAGCATATCACTGAACTGAATATAAAACCAACTTCACCTCAATAACCCAGAGCACTATCCCGCTTCAGAATGAGCCACGCGGCCCTTTGGATAAACTCTCACCTGCGTTCCCTTCCCCGCGCCGGGCGGCCCGAGCAGAATGGCCCGTATGCCT
TT/- CCGTATACCGGAGACGGTATCGTCCTCTTGTGTGCTAGGGGCCATGGCTACAGCTTCTTTACTAACTAAACACACTTCTCTCCACTACACACTTTGCGTCCACTAACTCTCTCAGCCTAGAAAGGAAGTGGTAACGCCTCCGTTTGCTGAGTATGGACTCAAAACCCCGCCTTCTCTCACCAAACTAATGATCTGATTAGCCAAAGGCACGCCATTCACACAGAACGCAAGCTCATTGGATGAAATCGAATGCCTCAGTATCACATAGCATCCGGATTTTGGCCTAGAATGACACATCGCACTGGAGGATCAAGATGAGCAGGTTTATATCACAGAGCTTTAGATAAGGCGGAATGAGATATCCGTATCTAAAACGACACCTTAATGGCTATATCAGAATGTTCAAAGGTCGTTATTACGCGTTTGTTCTTCCGACTTAATTGATAACTTTATATTAACCACAGATCATAATTTGGAGGTCTTTTAACATTTTAAAACCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations