Genomic Feature

tnr39

ID
ZDB-ALT-131101-1
Name
tnr39
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 21: 19484131 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
Missense mutation (1545 A>G) causing a Q516R replacement.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G at position 1545 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Gln>Arg at position 516 (1)
Sequences
Flanking Sequence
AGCTGTTTACCCAACACCATTTGCTAATTCAAGATACAGTATCTCAGATATTGATTAGTTTAGCTTCCATCTTAAATCCCAGTGACATTAAAACATTTACACATCACAAAAACGAATTACAAATCGAAATCCCTCACCCCAACTCGGGCTGATTTGTAATTGATGTTTTCATTAAAGCCTGCAGGAGTTCAACTTGGAATGTTACTTCATGCGTTTGACTTTTTTTTGCTGCAAAACTTCCAGATCTGTAGATCCACAGTTCTCAGCTCATTATAAAGTCACTCCACATCTTCAGAAACAACTTTTAGCCATGCTGCAGACGCTTTCTGATATCTCGAAAAAGCAAGTGCAAGATTTGATCAGATTGCAGGCTGTTCTTTAAGCAATGCCTCTCTTTCTGTCACAGGAGCAAAGGAAATTAGGCGGAGATGGAGTGGCTCCTGAGGGCCGCGGGACAGGGATGGACTGCGCCGCTCTTACCTGTATGGTTCAGTTGGCTC
A/G GGTTATTGTTGGAGCTGGACTGGGAGCTCTGGTCAATCTAGCGGGTAGCGTGATTGTAGTAGTGCTTTCTGCCTCAACAGTGTCCCTAATCGGCTGCCTCTTTATTGCTATCTTCATGTGATGTACAGAATAAGCCTCAAATAAATACCCTTTCTCTATTTCGCTTGGTTCGTCTCCTCTATTCAACAAGACATTTTGGGATGCAGCAGCATGAACGTTTGCTGATTCCATTAAGTTTTTTTCTGATGTACTGCTATTCACCTGCCACATTCATAAATAACAGTCTGTGAAGTTGAAAGAAAGATTACGTACACTCAAGGAAGAGTTGACAAGAAATGAAATGTTTGGATTGATGTTTTATGTCGTTTTGTTGCTTTTTTTTAAAGCGACTAGCACTGTCAAACCTTCATTTAAATATTTACTTTGAACAAAACAATGACTGGATTAAGAAATACAAACATTTCAGATTCTTCTCTTACTTTAATTTTAGTAATATCAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations