Genomic Feature

hkz3

ID
ZDB-ALT-130204-1
Name
hkz3
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Wen Lab
Current Source
Other Pages
Note
Sequencing of the cmyb locus revealed a T-to-A splice mutation leading to a competitive splice acceptor. the cmyb transcript contained a 13 nucleotide insertion between exon 8 and exon 9. This mutation leads to a truncated c-Myb protein lacking the transactivation domain but retains the DNA-binding domain
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 23: 31822034 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Sequencing of the cmyb locus revealed a T-to-A splice mutation leading to a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A in Intron 8 (1)
Transcript Consequence
Splicing Variant (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TGCAACACATTTATTAAACAGATATTTTTTATGTGAATCCCTCAAAAAATACACGCTTTCATGTCATTTTTCCCATTTATAATCACAATTTGAGCTTAATAAACAAACACTGAATTTACTTTGCTCTCATCTCACATAGAGACACTACAGCGACGAGGACCCCGAAAAAGAAAAGAGGGTGAAAGAAATCGAGATGCTGTTGATGTCAACAGAAAACGAGCTGAAGGGACAACAGGCACTACCAGTAAGTGTGTCTCTCTGTGCGTGTGTGTGTGTGTTTAATTGGAGGAAGCATCTGGGGGTCTATTTCACATGCTTCAACTGCTTGGCTAAATGATGCAATTGCACCTTATCACACCACAAGCTCTGTTTAACTCCTTGTGCAACTGAGAACCCCCTCCCAACCCTTCACATCATTCAACTCGACAAGTTCCCTTTCTCTCTGACCGCTTTTCCTGCATGCATTCCTCTCTTTCTTTCGCTTAATTTTGCTCTTTTTT
T/A GTTCCCCCACCCAGATCTCCATGAACGGCTACGGTGGCTGGAACAGAGGCTCTTTGGCGGACAGTTCGGTTGGCATTGTTGTTTCAGTCCCGGCTCCATCCCTAGAGCAAGGATGCCTTCCTGAAGAAAGCGCACATGGCAACACAAACAGCCCAAATAACGACTCCAGCTCCACTTTACCAGAGTTTATCGATGCTATTGATTCGGTAAGTTCATCTAAAATGAACAGTGACCATGTATTCATCAGCTAGCATCTAGCGTTAAAGGGATAGTTCACTCAAAAACTAAAAATTCTGTCATCATTTACTCACCTTTCACTTGAGTTTCTTTCTCCTATTAAACAAAAGAGAAGGTATTTTGAAGAAAGTTGAAAACTTGTAACCTTTGACTTCCATAGTATTTGATTTCCAACATACTACTCAATGGTTACAGGTTTTCAGCTCATCTTCTTTAGTGTTCAGCAGAAGAAAGAAACTCCTAAGTGTTTTGAAACCACACGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations