Genomic Feature

t25078

ID
ZDB-ALT-121204-2
Name
t25078
Synonyms
  • IP045 (1)
  • IP045TA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Boehm Lab
Current Source
Other Pages
Note
In the IP045 mutant, a cytidine to thymidine transition was found in the first residue of codon 336 of jak3 (t25078); the Q336X nonsense mutation is predicted to truncate the protein before the tyrosine kinase domains.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 8: 13395144 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
In the IP045 mutant, a cytidine to thymidine transition was found in the first  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gln>Stop at position 336 (1)
Sequences
Flanking Sequence
GAGAACTCTTTCAAATGACAAACTAGAATCTCTTTGTTCCTAAAACTTTATAAAATATTATAAAGCATTATATAATACGAAATATATCGTTCAGCATTATTTTCTCTCTGCTTACAGGAATGGCAGACATTCTGTGACTTCCCCCAGATCATTGACATTAGCATTAAGCGTCTCTGTCAAGAGCAGATGCCTCTGGAAGGAAGGGTGGTCACACTCACGCGCCAGGATGACCAGTGCATGGAAGTGGCATTTATATTCATACATTCAAGAATGAACACATAAACTAAACTCATTATAATAGAAATTATGCTTTGGTTCTGATACTAACAGCAAAGAGTACTTTCCTTCCTAATGAGTTTATATCTCAACCATTTTTATTTTATAATGTGTGAAAGTATAATAAATTGAAGCTTGTTTTTTCCTCTTAATTCTACTTTGCATATCAGTTTGTTTTACTTTGTGCCTTTTCTGACTCTTTCTGTTAACAGGAGGCTGAGTTT
C/T AAACCCTGACAGACGCCCTTTCCTTTGTATCTCTGGTTGATGGATATTTTAGACTGACCACAGATTCAACTCACTATTTCTGCGCAGAAGTGGCCCCACCAAGCCTGCTGGAGGACATACAGAATTACTGCCACGGCCCGATCACGTATTACACAATTTCACATTTAACTGTATTATCAAATTAGGAAATGATTTGGGACACATCCTAGTCCATTCCTGGTTTAGTACTTAGTAATAGTAGGCACTAATCAGGAGGTTCTCAATTCTCAAGGTGCTCTCTAAATATCCCCTAAAATGCTCTCATATGCAAAAGCAATATATGTACACAACCTAACCTAAGTCTTGTCATTGATGCCAGTTGTAAAAGCCACAAATAATAACTTGACTTCTAGTTGATCATTTGGAAAAGTGTCAGAAGGCAGATTTTTTCGATGGATCATCTGTTAAACTGCATCCCAATCATCACAAATACTGCAGAAGACCTATTGGAACCCACATGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations