Genomic Feature

vu270

ID
ZDB-ALT-121112-5
Name
vu270
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Lila Solnica-Krezel Lab - Vanderbilt University
Current Source
Other Pages
Note
vu270 is a nonsense mutation in the lmo2 gene. A T to A transversion generates a stop codon at position 94 (C94X), the beginning of the second LIM domain of the lmo2 gene product.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 18: 38295634 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
vu270 is a nonsense mutation in the lmo2 gene. A T to A transversion generates  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Cys>Stop at position 94 (1)
Sequences
Flanking Sequence
GGTGTCCACTGGTAATAGAACATATTATTTTTGTCACATATTTGTTTCTTTTATAGTAGGATTTCAGATGAAGCCTAGGTTCTTTGTTGCTGTAGTGGTGCAAAAGCATTTAAAGGTTTAGTTTACCTGAATAGAAAAATGTACTAAAATATTTGTGAGTTTTATCTGTTGAAATAAGACATTTTGGAAAAAAGTTGGAGGCTGTTAAACCATTGACAACCGTAGAAAAAAAATGGAAGTCAATGGCTCCCATTTTAAAACATAAAAAAGCACCTTCATTGAAGCTCATTTGTGTTCACTAAAGTAAAAAAAAAACTCAAAAAGGTTTGGAACTATTCTATCGAGAGTAAATAACAGAATTGCAATTTTAATCAAATATCATAGACTGTAAAATGGGTGAATATTCCTTTCATAAGTTTAGCTCATAGCTCCCTCTGTTGGTCAAAATAATCACTATATTGTTTCCTTCCTTTCAGACTGTTTGGTCAGGACGGACTCTG
T/A GCTTCCTGTGAAAAGAGGATCCGGGCCTTTGAAATGACCATGCGTGTGCGTGACAAAGTCTATCACCTCGAATGCTTCAAATGTGCTGCCTGTCAGAAACACTTCTGTGTTGGAGATCGTTACCTGCTCATCAACTCGGACATTGTGTGTGAGCAGGACATTTTTGAGTGGACCAAACTCAACGGCAGCATAGTATAGTTTTCTGCCGAAATCATAAACAAAATGTAACCTGTCAGCATTTTCAACAAACCCTTTACTAATAGAACATCAATAACAAAATATATATTTTAAAGAAATGATCTTTCTGGCTCTATTAGCTGTGCTCTAAATGCTTGTCTCTTTTTGTTATTTAAACTTGAGAAAAATGCCACCAGGTTTCCCAGTGTTGGGTTGCAGCTGGAAGGGCATCCACTGCGTAAAACATATGCTGGATAAGTTGGCGGTTCATCCCGCTGTGGCGACCCCTGATTTTTAAAGGGACTAAGCCGAAAAGAAAATGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations