Community Action Needed: Please respond to the NIH RFI
Genomic Feature

pc2

ID
ZDB-ALT-120927-3
Name
pc2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Peter Currie Lab
Current Source
Other Pages
Note
Mutation in exon 32 the C to T mutation causes a R1497 to Stop. Gene verified by noncomplementation with dmdta222a.
Mutation in exon 32 the C to T mutation causes a R1497 to Stop. Gene verified by noncomplementation with dmdta222a.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 10950563 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
Mutation in exon 32 the C to T mutation causes a R1497 to Stop. Gene verified  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T in Exon 32 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop at position 1497 (1)
Sequences
Flanking Sequence
CATTTCTAATAACTGATTTCTTTTATCTGCCATGATGACAGTACATGATATTTTACTAGATATTTTTCAAGATACTAGTTTTTAGCTTAAAGTGACATTTAAAGGCTTAACAAGGTTAATTGGGCAAATTATTGTATAACAGTAGACAAACTGAATAAAGGGCTAATAATATTGAACTTAAAATGGTTTTTAAAAAATGAAAACTGTTTTTATTCTAGTCGAAATAAAACAAATAAGACTTTCTCCACAAGAAAAAAATATTATCGGAAATACTGTAAAGAAATTCCTTGCCATGTTAACCCAAATTTGGAAACTATTTGAAAAAGAAAGAAAAAAATATTCAAAGGAGGGCTAATCATTTTGACTTCAACTGCACTCAAATGTATCTAAACATTCTACATTACCCACCATGCACTGCTCAAGCTGTGACTGCACCACTTCCTGCTCCACACTGCGAATACTCAGCACTCCCAGCTTCACTTTCACCTCCTCCAGCACTC
G/A CTCACACTCCCTCAGCCGCTGGTCAAAGTTCGCTGGCTTTTGGAAAAGCCGGAACTTGCCCTTTACTTGCAAAAGTTTATCCTTAAACAGACACATTTGTTTACAGGCATTTCATTATTTCACTTTTTTGTGCAGAAAAAAACTATGAAAATATGATATGATTTTTAAGTCTTACTAATGTTGCATCGATCTCTCCAATCACTTTCTCTGAGGCGTCAACCTCCATAGCCTTTTTCTTCATGTCATCCAGTGTCACCTCATGGCCGTTCAACTCAGTCTGAATTTTCTGTTAAAAGACACAATGATATGAGGGTCACTGAAATCCTTACAATTGTTCTGATTGAAAAAATAAATGGATATGCAATCAAGTAACAAATAAATAGTTAACTGATTTGTATTTGAGTGAGTAAAAAACAAAACAAAAAAAAGAATGTAGAAATGCATGAATAAAATAAAAATGAAATGTAAATGGTGCAAAATTAAAACAGTTAGTAATTATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations