Genomic Feature

i232

ID
ZDB-ALT-110708-1
Name
i232
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Ingham Sheffield Lab
Current Source
Other Pages
Notes
Comment Citation
i232 is a point mutation (thymine to adenine) in the second exon of evx1, which  ... Schulte et al., 2011
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 19: 19720059 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
i232 is a point mutation (thymine to adenine) in the second exon of evx1, which  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Tyr>Stop (1)
Sequences
Flanking Sequence
AGACGCTGTCTCTTGTCCTTCATGCGACGGTTCTGAAACCAAACCTGTAGCAAAATAGACATAAGGCAGATGCAGTAAATAATGAGGCCTGGTGCATTTAAACCCCCATTTAAATGAGCAATAATAAAAAAAATGCTCACAAATACAGGTCTCAGAGTTGGTGTTGCTTTATTTCATATTGAATTGTAATTATTTTTTTTTTATCTTATTAGTTCTCGTTATTTGATAAAATTGATTGTATTGTTTAATTGGGACAGCATTGGCAAGGATTACTAGGCTACATTTAGCTTGTAGGTATAAGGTCATCCCTATCAATAGAAAACGGCCTACTTAAAACGGTAATGTCAAATAGAATCGGACTTGCAAAGCAATACCTTTATTGTGGTTTCAGGTAAATTTAAGGCAGCCGCCAACTCGCATCTGCGTGGCCTGGACACATAATTTTCCCGGTAAAACTCTTTTTCCAGTCGAGCTATCTGCTCCCTCGTGAATGCTGTTCG
A/T TACCTTCGCATCTGGTCAGAGCCATAGTTGAGAGAACCGGGGACTGAGCCAATCTTGTCCACACCGACTTCCTTTCCGTGCTTCGGCGAGCCCATTGCCAATCCTTACAGAAAATGAACATTAGTATTTAAATAGCATCTGCATAAACTACATGGGTACTGCTTATCCACTGAAAAAAAATAAAATGCTAAAAAGTGTATTATTATTTGCATTGTTACAACAAATTAGGAAAAATATGACTCTGAATAACATTTAAAAATAGTTTTACTGAATAAATAGCTAAAATTAGAGCGCAAACCCCCATGACAGGTTCAGAGATTGAAACGACATTTTATCAGATGTTTTTCTATCATGTTTTAAAATATAGCTTGAACAAATGACAGGGTATGAAAATACATTACATGAATTACTGGAGATTCGGTGACAGTTTATATTTAGCAGAATAATATGACATAATATATAACAATGTATGCATTTCTAAAAATGCCTATCTTCATTCG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations