header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-100628-3
Genomic Feature: sa90
Synonyms: sa0090 (1)
Affected Genomic Regions: ptgs2a (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 20923002 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCCAAAACTGCCCAACGCCTGATCTCCCAAATGCCAAGCAGGTGGTGGAG
C/T
AGGTGCTGTTGAGGAAGCAGTTCATCCCTGATCCACAGAGGAGCAGTCTC
(1)
OTHER sa90 PAGES
ZMP:sa90 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Unknown ptgs2asa90 ptgs2a Unknown

CITATIONS  (4)