Genomic Feature

fr23

ID
ZDB-ALT-100526-3
Name
fr23
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Hammerschmidt Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 7: 69691480 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
The rfl fr23 allele of frem1a displayed a 2487T>A mutation leading to a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A at position 2487 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop at position 829 (1)
Sequences
Flanking Sequence
GTGTGAACTTTGGTTCCGACCACAGTTGTTCCCAACAGTTTATTGAAAATCGCGACGACGCGGGGCCCCCTAATCATGCGGGGCCCCCCCGCGGTGCGTGCCCTGCGGGCCCGTCCGCTACGCCACTGAATTCAACCACTGAGGTTACATGGAGCGCTTTGGTTTCTTTTCTTTGAACATCTCCGAACCATTGCTGTTTATGGAAGATGAGAGAGCTCCAGGATTTCATCTAAAATGTCTTTTAATAGTATAAATTTCCTTTTTTGGGTGAACTAACACTGTAAAACGGTAATCGAAGTAATATTTTTACTCTGTAGTAATACTTTACTTACATATAGATGTGTCTGCGGTGGTGTTCAGGTGCAAGTGAAGCTGCTGGTAGTGGATGAAGGAGGTGAGATCTGGGTGACTGAAGACCACATGCATCTCTCTGACCGGGACTCACTGCAGGACTCAATACACGTGGAGCTGAAGACTGCACCTCAACATGGCAGTGTTTA
T/A CTGGACGGCAAACTCATGGTTCCAGGCCAGACTTTCACTGTGAGGGATCTGAAAAGCCTAAAAGTGAGGTCAGATGTGGTTCCTTATCGTTTGATTGTGTTTTTCATTAACACTTAGTTCACCTAAAAATACATTGGATGGGTTAAAGCTACTGATTTAATATTTCTGAAATCAACATTTCTACATTTCCTTATGTAAATATTCATTCATTCATTCATTCATTTTCTTTTCGGCTTAGTCCCTTTAATATTCTTGGGTCGCCACAGCAGAATGAACCGCCAACTTATCCAGCATATGTTTTACGCAGCGGATGCCCTTCCAGCTGCAACCCATCTCTGGAAAACACCCATACACACTTATTTACACACATACACTGCAGACAATTTAGCTTACTCAATTCACCTGTACCACATGTGTTTGGACTGTGGGGAAAACCGGAGAACCTGGAGGAAACCCATGCGAACGCAGGGAGAACATGCAAACTCCACACAGAAACGCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations