Genomic Feature

zy7

ID
ZDB-ALT-100429-1
Name
zy7
Synonyms
  • dzy7 (1)
  • I166T (1)
  • zy7 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Yost Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 24091259 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
Reported as a thymine to cytosine transition in codon 166 in ZDB-PUB-100119-13.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Ile>Thr at position 163 in GenPept:P79734 (1)
Sequences
Flanking Sequence
ATGTGGAGATGAAATGAAAGCTGCTAACTTCATTTCTGCTCTGCTTCTCTCGTTCACTCTCTTGTTTTGGCTGTTACAGTGATTCTTGTGGATCCACACACGCACACGAGCACAATTTTATATATAGTTTTAGTTAAATTTAAAATACTTTAGTTATTTTCTTAATTTGTCATGACGGCTGACAACTTTATTGTATTGTATTATATAAAAAGTGGTTTCAAATAAACAGTAGCATAGTGTACTTTGTGATTATGATTGGTCTTTTTTGGTGCTGTTAAAGCCACCACATCAAACCTGCAGCTCTTAAAAAATTAGTAAATTGCATTTTTAAATTGCAATTTTGATCAGATAAATCGCAATTAGATTTTTTTTTTCAAATCGTGCAGCCCTACACTGGAATACACAAGCTAAACAATTATAAGGTGTTTACTTTTTGCACTGAAAGTTAATATCTTGTCTGTTTTCTCCCTGCTCAGACTTGGCGCCTGCTGGTCATTTGA
T/C AAGAGTGGAGGGCAATCAGCGAGCAAATTACAGGGAAGATAACATCACTTTAAGGCATAGTGTTTTTGTCCCATATGAAGCACCACAGGTTAGTCTCTCTATTTTGATCTGTTAAAAAGTCTACCAGTATTGTAGCCACTAGTTGAACCTCATTAATGCTTTTGATTTTATTTTCATGGAAGTTTAAAGTTGATATTGAAGTTGCTTTGGTATGTCACAGCCTTTTTGTAGGACCCTACCAAAATGTTGTTTTTCCCAAATGTATGTTTATGCAAACTACATTTTAGTAATGTAAGTGTGCATAGTAATGTAGTAAGTGTATAAAATGTAACCTTTAACATAACTTTTTCCTTTATTGCAGTCAAAATTAACATTTCAGAACAGTTGAGTATAAATTACTTGAATGCATTATTACATTGAGAAGTCTGTTCTGCTGTGATATTTTTATCAGTTTCTTCACAGGAAACAAATTTTCATGGCATATTTTGTTTTTGATATGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations