ZFIN ID: ZDB-ALT-100429-1
Genomic Feature: zy7
Synonyms: dzy7 (1), I166T (1), zy7 (1)
Affected Genomic Regions: tp53 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Yost Lab
Location: Chr 5: 24091259 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Ile>Thr at position 163 in GenPept:P79734 (1)
FLANKING SEQUENCE (GENOMIC)
ATGTGGAGATGAAATGAAAGCTGCTAACTTCATTTCTGCTCTGCTTCTCTCGTTCACTCTCTTGTTTTGGCTGTTACAGTGATTCTTGTGGATCCACACACGCACACGAGCACAATTTTATATATAGTTTTAGTTAAATTTAAAATACTTTAGTTATTTTCTTAATTTGTCATGACGGCTGACAACTTTATTGTATTGTATTATATAAAAAGTGGTTTCAAATAAACAGTAGCATAGTGTACTTTGTGATTATGATTGGTCTTTTTTGGTGCTGTTAAAGCCACCACATCAAACCTGCAGCTCTTAAAAAATTAGTAAATTGCATTTTTAAATTGCAATTTTGATCAGATAAATCGCAATTAGATTTTTTTTTTCAAATCGTGCAGCCCTACACTGGAATACACAAGCTAAACAATTATAAGGTGTTTACTTTTTGCACTGAAAGTTAATATCTTGTCTGTTTTCTCCCTGCTCAGACTTGGCGCCTGCTGGTCATTTGA
T/C
AAGAGTGGAGGGCAATCAGCGAGCAAATTACAGGGAAGATAACATCACTTTAAGGCATAGTGTTTTTGTCCCATATGAAGCACCACAGGTTAGTCTCTCTATTTTGATCTGTTAAAAAGTCTACCAGTATTGTAGCCACTAGTTGAACCTCATTAATGCTTTTGATTTTATTTTCATGGAAGTTTAAAGTTGATATTGAAGTTGCTTTGGTATGTCACAGCCTTTTTGTAGGACCCTACCAAAATGTTGTTTTTCCCAAATGTATGTTTATGCAAACTACATTTTAGTAATGTAAGTGTGCATAGTAATGTAGTAAGTGTATAAAATGTAACCTTTAACATAACTTTTTCCTTTATTGCAGTCAAAATTAACATTTCAGAACAGTTGAGTATAAATTACTTGAATGCATTATTACATTGAGAAGTCTGTTCTGCTGTGATATTTTTATCAGTTTCTTCACAGGAAACAAATTTTCATGGCATATTTTGTTTTTGATATGA
(1)
Comment Citation
Reported as a thymine to cytosine transition in codon 166 in ZDB-PUB-100119-13.  ... Parant et al., 2010
OTHER zy7 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tp53zy7/zy7 tp53 ♀+/- ♂+/-
tp53zy7/zy7 (AB) tp53 ♀+/- ♂+/-
Heterozygous tp53zy7/+ tp53 ♀+/- ♂+/-
tp53zy7/+ (AB) tp53 ♀+/- ♂+/-
Complex tp53zy7/zy7; esco2hi2865Tg/hi2865Tg esco2, tp53
tp53zy7/+; cz1Tg tp53
tp53zy7/zy7; cz1Tg tp53

CITATIONS  (8)