Genomic Feature

hg1

ID
ZDB-ALT-091019-1
Name
hg1
Synonyms
  • w84x (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
P. Paul Liu Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 1395348 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
truncation of the mutant protein is in the Runt domain
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A in Exon 4 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Trp>Stop at position 84 (1)
Sequences
Flanking Sequence
TTCAACTTTAAAAGAACCCAAAAAATAGCACAAACGAATCAACTACAGTCAGTGTTATGTAAAAAATAATTGATCATGTGCCACAGAACTATTCGTTCATTCATTTTCTGTCCCTTTATTCATCAGGGGGTCACCACAGTGGAATGAACCGCCAACTATTCCAACATAAGTTTAGCATTTGCCCTTCCAGCTGCAACCCAGTGCTGGGAAACACCCATACACACTCATTCATTCACACACACTCATACACTACGGCCAGTTTAGTTGATCAGTTCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGAAAACCCACAACAACACGAGGAGAACATGCAAACTCCAGACTGAAATGCCAACTGACCCAGCCGGGACTCTAACTAGCTTCTTGCTGTGACACTGAGCCACCAAGCTGCCCAAAAATAACCCATATAAAACAGGTTCTGGTACCTTGAAGGCGATGGGCAGGGTCTTGTTGCAGCG
C/T CAGTGTGTCGGCAGGACGGAGCAGAGGAAGTTCGGGCTGTCGGTGCGCACCAGTTCCCCCGGGTGGTCGGACAGTACTTCCACCATGCTGCGGTCTGCCATGCGCAGTTTGCCCACCAGAGCGGCGCCGGTGCTCTCCTGAGCCCCCAGAGGCAAACCCTCGCTCATCTTCCCCGAGCTCAGGGTGGTGGAGGGAGGCGTGAAGCGTCGCCCGGGCGCAGGTTCTGAAACACAGGCCAGTGTTAAAGTGAATTCAACAAGGTAAGGCAAGCTTACGAATAAAAGAGACAAGTAAAAAAAAATTAAGAAAATAAAAACAAATATTATTAAAAACAGATTAAAATGTGTTAAAACAGGAATAATAAGTGCTCACGTGGGTTTCCCCTGGCTTCCCGGTTTCTTCCCACTATCCAAAAACATGCAACTTAAGTTAATTGACTAATTTAAATCGCCACCATAGACATGCTCCTAGTGAGTAAATATCCCTTAAGAGCGATCACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations