Genomic Feature

fh275

ID
ZDB-ALT-090715-2
Name
fh275
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Moens Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
On XM_677713 the mutated nucleotide is c3064t leading to Q1022*.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 26296952 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
On XM_677713 the mutated nucleotide is c3064t leading to Q1022*.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T in GenBank:XM_677713 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 1022 (1)
Sequences
Flanking Sequence
GAATTCTCAAACTCAATGTTCTGAATTCACAAAACATTCAGTATTTGAACTTTGTTCAAGCTCACCTGTTTGGGAATTGATTTGGAAGTATCGGTCAGTATGAAGTAATCTGTACGTAAGGCGACTGTTGAGACCAGCATCGCGATCAGTAGCAGATACCCTTCCAAAACCAGTCCCAGCAGGCAAGTTCTCTCTCACCGCCAAGAAGACCCTCTCCTGAGAAAAGCGAGGAGCGTTATCATTCTCATCCGTCACTGAAACTCTAATTGTAGCACTACCGGTCCTCCCCATCTGCCCGCTTCCAGAAGTAGCAAGTACAGTCAGCAGGTAGATATCCTTGACTTCTCTATCCAAAGCACTTTTAACAAACAGCCAACCACTGTCTGGGGCAATCCCGAAACCCACTGCATCCCCATCAGGCCGGAGCCGGTACGCCAATGTGGAAGTCGGTGTGGACGATCCTCCATTTCCATTGGGATCTCTATTGAGTGCCCGGACCT
G/A TAAGAAGTTGGTGTTTAGTGGTGTGTTCTCCTTCAGCTCCACACGGTAGGTTATTGTGTCAAACACAGGTCCCTGATTGTTCTCCGCCTGGATGTGGACTACTAGACTGAACGTGGCACTAAGTTGAGGAGCACCACTGTCTTTGGCAATAACTTGGAGGTCATAGCGAGGTACGCTATCGTACGACAAACTCCCAATTAACCGGACTTCACCACTGCTACGCTCCACACCAAACGTGCGCTGTCCTCCGGAGGAAATCAAGTCGAAGCTTAGTTGCCCATTAGGACCCGAGTCCCGATCTTCAGCCTGTACACGGTACACAATAGTGCCCATTTTTGTGGCTTCTGGCAAGAGCAGAGATTCAGAGGATGACGGGAAAAATATGGGGGCATTATCGTTCACATCTGCAATGGTGACCCGAACACGGGTGTCTCCAAAAGCTGGAGGTGATCCGCTGCGTGCTTGAATTTCCAAGTCGAAAAAGGGTCGTGACTCGTGGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations