Genomic Feature

nz171

ID
ZDB-ALT-070819-1
Name
nz171
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Crosier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 16: 48423230 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T at position 829 in Exon 8 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Gly>Stop at position 277 (1)
Sequences
Flanking Sequence
GAATTTTGGTATTGAGATCGGATTGGTTTGAAAAAAAACGGTAATGGTGCATTTCTAGTCCTTGGTGATTTAATGTTAAGTTAAACTAACAGTGCTTCCACCAGACCGGGAGACCATCTGAATGGATTATAAAAAGGTAAAACTCAACTTTTACAACACAAGGAGACTAGTAAAATTAGCCTATTTTCAAAAAAACAAACTGTTGCTTTAAGGTCTATGTCACAATGCTGTTCTTAATCTTAGTTATAATAAAGCTCATTTTATTTGAACTAATAAAAGAAACTGCTATAACAAGAAATGAAAATAACAGGTAGACAAGAGCTCAATGGATTGAAGTTGTAAAATTATGATATTACATTTTTTTAAATTAATTTATTGTTTATTTTTACCAGTGATGTCGATGGGCTCAAGAGCGAAAGCTTCATCCTCATTGGGCACCAGAGTGGTCTGTTCGGTCTGATCTGTCTGGTCAGTGGTGTTGGGAAGAGGCTCCACGGGTC
C/A AGAGTCTGGACTGTCTGGACCTCCAGCTGCTGAAATGATAATGCAGAAACGTCTTATGAGGTCCAAATAGCATGACAAGAGGAACTGTTATTACAGGAAGATGATTTCCTCATTAAACAAGTTACTCATCTTTATACAATTATAAAAAAAAACCTGAAAGACATTTTAATCACTTAACAAGCTGTAAATGGTACAAACCTGTCCCAAAACACATGTGTTACTGTAACAAATAACAAACCTCTAAACCAGGGGTCTCAAACTCGCGGCCCTCAGTGCAATATTTTGTGGCCCGCGCCGACCGCTGTACACTGACAGAATCAGCGGAGCGGGGAGAGAGAGCACTCCCCGCTCCGCTGATTCTATCCATACACAGCGGTCACTGGCATTCCCCGCCCGCCGTGTTGTCGCGCGCGTTCTCATCAGCGGTGTTATCGCGCACCTACTGAAGGGCGGGACCGAGGGTGTGTCGCGTCACGGGGGCACTTTTGATCATTTTGGAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations