Genomic Feature

j16e1

ID
ZDB-ALT-070423-1
Name
j16e1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stephen L. Johnson Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 28249598 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Gly>Ser at position 270 (1)
Sequences
Flanking Sequence
GGCAATTGCTCCAAACCTGGAGAGTGTGTGTGAGTATTTATGATCAAGCATAAGCATCAACATTTTCATTTAAATACGTTTTAGCAAGTACATTTTGATGGAAAATGTGAATATCCAACACAGTCTCACAGCAATTTCTAACGTTTTGGTTTAGTGGTGAATTTGTATCTCATTTGTATATTTTTGTATGATTTGCTCAATGATGGGGTTTAGGGGTCTCCTTTTTCCAAAACCATACATTTTTTTATATTAATGAAATTGTATGACTACAAATTAATTAGCCACTTTTATGACAATACTTAAAATAGTTTTAGATTGTGCTGGAACATCTTGTATATTTGACCATATTTAATGTGTCTCTTATAAAGGATTCGCTTTTTTTGTATTTCAGATGCAGAGAAGGATGGCAGGGTAAATTCTGCACAGAGTGTAAAACATATCCAGCCTGTAAACACGGCACCTGTCACCTGCCAGGGCAGTGTAACTGTAAAGAGGGCTGG
G/A GTGGACTGTTCTGTGACCAAGGTAAGACTAAACCCTAGAGAGTTAAAGAAGCTGACTGAATGATACTCTTTACTGACCTCAGTGTCACACTTAAAGTAATATTAGAGCTTAAAGCACTTTAGTTCATTGCTAGTTTCAGATTAAACAAGTAAACCTTTTCAGTGAAAACTAGAAATCATGACTGGATTTGATTGAAAATATGTCTTTTTCTAGTACTGACATATTTTATGATTTCTTTCGAAACAGATTTGAACTTTTGCACACACCATAAACCATGTGTGAATGGAGCCACATGTATGAATACAGGTCAGGGCAGTTACACCTGCATCTGTCGACCTGGCTACACCGGGGTCAACTGTGAGCTGCAGGTGCGAGAGTGTGACAGCAGCCCATGCAAGAATGGAGGTCTTTGCACGGTGAGTAATTGTTTAATTTAAAACCTTCCAAACCTCTACGACTTTAAGGCCACAGAGGGACGCTGACTCAATTCTGACAATATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
j16e1.pdf
Citations