Genomic Feature

hu2526

ID
ZDB-ALT-070315-5
Name
hu2526
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Hubrecht Institute
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 68807513 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
hu2526 contains an A>T transition at position 208, resulting in a premature  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T at position 208 in GenBank:AF240772 in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop (1)
Sequences
Flanking Sequence
ATAATCAAAATCTACAAATAAAACCCTTTATTTTTTCTCATGGGAGCTGATTGACAAGCAAAAAAATAGCAGCTCAGGGATTGGGTTAGGTTAGACAGGGGGCGTGGCTTTGCCACCACGCGCCTGAACGCCTATAAAAACCGGTGCTGCGCATCAGACTTCACATTTCACATTTGTTAACGCACCTCGATGAAAGACCTCCACCTGCATACCTAACAGAAGAAAGCTTGGACATTTTCTGGAATCATATCCTCACTGATATCAACTATTGGAGTACACGTGCAATGAAAATCCTGGCACAGACTGAAAAAATCAAAATGGACAGAAAGGTAACAACTTGTTTCCAGATGAATACCATTGAGACATGCACATGCTGTAATATTAACCAGTTAAAACGTGATCTGTTGACTGACATTAGTCCTTTGCGTTTTCTGAAGCTGTTAAAACCTCAGGTAGAAAGACGTAGAAGAGAAAGGATGAACCGGAGTCTAGAAAACCTG
A/T AACTTCTGCTCCTGCAAGGCCCAGAACACAACGTAAGACCACCTTTTGCTTTTAAACACAGTGGCATCTATGAATATGTGACTAGCTTGATCCAAAGCTGATTTATGTCAACTCTTATGTTTTGTAGCAACCTAATCAGAGACGATTAGAGAAAGCAGAGATCCTGGAATACACAGTTCTGTTCCTGCAAAAGGCGAATAAAGCGAGTAAAGAAGAGGAGGGAGAAGAAAAAAGCCAGTTTATGGAAGGCTTTTCTTCCTGTCTTCAAAAAGCAGCCCGCTTTCTCTTGGAGGAAGGTGGACTGGAAGGCTCGGTCACATCCATGCTGTGTCAACGTCTTGCTCACCCCACCATCAGACTGCCTGTCAGAGGTCACTCCAGAAAGCAGCACGCAGAATCCAACCCACAGCATCATGCGCGTCGTCCACACCACAAAAACACTGTCTCCAAAGCAGGACATCCATCAGCTTGCAGGAACACCAAAGAACCACAAGCGAGCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations