ZFIN ID: ZDB-ALT-061207-4
Genomic Feature: st49
Synonyms:
Affected Genomic Regions: adgrg6 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Talbot Lab
Location: Chr 20: 37447933 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 782 (1)
FLANKING SEQUENCE (GENOMIC)
TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAACACATATAAGATCACCTCTGCTCATCAAAAAAAAAAAAAAATTGCTACAGTATTTTTCATTAATAATAGAAAAAAAGTTTCCATCTTCCAGACTTTTGAATGGTGTGTCATTAATTTGATTAACATATGTATCTAATTATATGTTCTTTACCCAAAAGCACAATTTTTTATACCGCTAACAAAAGTGATATCATCTGCCCACACTTACAAAAATGACAGATTTATACAAAACAAAAAGATTGAGGAATCATTTTACATGTGTCTTACTCAACCTAAAACACAAGTGGGTTTGTCTTGACACTGTTTAATTTCTTTTTAGGATCATCAAAACAATGGCTTGACGTTAAACAGCTATGTGGTGGCCAGCAGTGTTGGCAACTTCACCATCAAAAACCTGCAGGATCCTGTCAGGATAGAGATTGCACATTTGGAGTA
T/A
CAGGTATTCATATTCTGTCAGTAAAGGTACAGATTCTTTATTTAGCTTGATGATTCCATGAGGATCACCAATAGAGCATCTTTTCATTCCACAAAATGTATTTTATAAAGAAAAATGTTCTTTAAAAATGTAAAGCATTTAAAAACTGTACAAAAAACCTGTTTGGTGTGTTCCGATACCTTTATTTTTCAGATTGTGCACAGTTCTATCAATATTAAATCATCTCTGTAGTAAGCTGTACTTAGTACAGCGAAATTAGTGCAATCATTAAAGTGCAAAAACAAAAATAAATAGGATAAAATATTGCTTCAATTATAGTGAGTTTTTATACGCATAAGAATATAATTACAAATTTGTACAAAATTAATGAAGTATTGATATAATACTACACAGTGATTGAATATGAAGAGAAAGTGTTAAATGCAGTATTGCACAAAATATGGATGTGTTAAAGTGTCAAGGTCTGTTAAAAAAATCACCTTTCAAAGTTTAAACTGAAG
(1)
NOTES
Comment Citation
st49 introduces a premature stop codon.
early stop codon in the GAIN domain  ...
ZFIN Staff
OTHER st49 PAGES No links to external sites

CITATIONS  (15)