Genomic Feature

t30963

ID
ZDB-ALT-060608-95
Name
t30963
Synonyms
  • NL144XA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
[Elks 2014] mpx-/-NL144 "spotless" mutant line harbors a C to T point mutation at nucleotide position 1126 of the mpx RefSeq mRNA sequence(NM_212779) resulting in a premature stop codon (M. R., E. M., W. Horsley, N. Trede, and P. Herbomel, unpublished data).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 7783325 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
[Elks 2014] mpx-/-NL144 "spotless" mutant line harbors a C to T point mutation  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGAACATGCAAACTACACACAGAAACGACCACCGGCCTGTTGAAGGACTAGAACCGGTGACGTTCTTGCTGTGAGGCGCCAGTGCTAGTCTCTGGGCCACCGTGCTGCCCTATGGAGGGAAAGGTGAAAAGGTAGGGGTGGAAGGGGGGATTCTTCAAATCGAAGATGACTGTAGTGAAAAAACCCTGGCTCTTTATAGTGGGTTAGGAATGGCCTGATTGGTGGATCATGCATGCTAATTTAGAACCAGCCGTGTTCAATCATAATCACGTGCTCCTCTCGATATTAGTTTATGAATAAACTTCACTTTAACTAGATTTACCAATGGTGACCAGTAATATGCCTGATAACTGCATATGAAGAAATAAGATTTAAAGGATAACAAAACTTTAACATACCCGCAATGAAGCAAGGAACCTCTGTCAGAGTGCTGTCGTTGAGGATTTTCTGACGAGTGGCGCACAAGTTGGTGTTAACACTAGTAAAGGGCAGGAGCTCTC
G/A TCCATTGTCTTTAAAACGATTATTAACACGTAAAAGGCCACCATCATTAGTAAGGTCCCGCAGTTCCTTTGCTAGTCCATCCTCTGAACCGTAAACTTGTCCAGCATCTAGGTAAGCTGTTAGAGTATTGATCTGTTCCCGAACATTTGGGACTTCACCAAACATGTAGGCAGTGTGCCCAGAACCACAAGTCGGTGCTGACCGGAAGACAGGGAGACAGGTGTTAGGGCGCAGACGCTGATCTCCTGGAGGGGCCTATGTTAAGAGATTAAACATAGCATGAAAAACTGTTTTACAGCTACAAGGGTTTTACAATGCAATAAGATGAGCAGTCTTTGACTGACCGAAATTGGGAAGCAGGGTTCAGAGCGCTCACAACTGTTTTCACAGTCAATGCCATTACTAAAGGACCTAATACTTGGTGAGAAAGGTGTAAAAGTCAGATCGTGGTCAACCCATTGCCCAAAGATGGTGAGCATGAAGGTAAAGTCATGGTCACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations