Genomic Feature

t30516

ID
ZDB-ALT-060608-480
Name
t30516
Synonyms
  • medusa (1)
  • NY054 (1)
  • NY054LA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
A G to A base change creates a premature stop at codon 33.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 30806598 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
A G to A base change creates a premature stop at codon 33.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Phe>Stop (1)
Sequences
Flanking Sequence
TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAATACATATATTTTACAATACAATACTCACTGATATCCCCAATAATATCTAAATTTATCATAATATAACTTCTAATCTTGATGTCAGAAGTTTCAGTTTCCATAGAGGACCTATGCCTCAGCCTCTCTGAAAACTGTGCTGGTTGTTATTAAAGAGTGTTGCAATAGTGAGTTTGGAGCACAGATCTATTACATAATAGATTTCGAAAATTTGACCCAAAAGTTTCATTTTTAGTCAAGGATGCTGTTCCGTTTTACAGCACACATCTGTGGTGTGATTAAACATGATTATTTGTATTTATGGCCCTTCTCATTATTCCATCCAACGTTCACATGCACTGAATTAAAAGCATCAAGGAAACAGCTGAACTGAGTTTCTCTTAATTCTTCTCCAGCCAAGCCCATCAGCCTGGTAGAGAGATGCTG
G/A TGCCGTTCCACAGTCAACACAGTCCCACAGAGAAGCATTCGCGAGCTCAAGTTCCTCCACACACCCAACTGCCCCTTCCAAGTCATGTGAGTATCTGCACTTTCCTTCTCGCTCAGCAGCTCTTAACAGCGCATCACCTCACCCCATCAATCTCCAAACACTGAATGGGCCAGGAATTGGCATTATACTGTCGGACAGGCTCTCACAATTACACACATCCAAGAAATGCTATGGGAGGGGGTAGGAGCTTTAAGCATGGATGCATTTGTATTTTGTACAGGAAACCAGCAAAATGAGGTCCAAAAGATTCTTCTTTCTCACACATGTAAAGGAATTGTGCTTAGTCAGACACACACACAAATGAAGCATTGATGTTACTTTATGTAATTATGATCAACTTTTCTAATTAATTCAGACAAATAGAATCCATGAGTGAGATTCATTTTAAACCAATGAGATTGTTTCAACAAACGACACTTTTATTTAATTGATCTTACCTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations