Genomic Feature

hu745

ID
ZDB-ALT-050914-2
Name
hu745
Synonyms
  • mcr (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Clevers Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 1887755 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gln>Stop at position 605 (1)
Sequences
Flanking Sequence
AAGAAGAACAGCTCGAGGAACAAACTCCCAGCTACAGCATGAAATACACTGAGGATCATCATGTAGAGCAGCCTATTGATTACAGTTTGAAGTACTCGGAAGCTCCTTCCAAGAAGGGCATGTTTAGTCATTCAAAGACGTCTTCTGCACAGAGTTCTGCCAAAGAACATTTAAGCCAGGATAGTTCTTCTTCTGTGGCATCTTTAAAGAATCAGGGCAGGCAAAAGCAGCTCCACCCTTCATCTGCTCAAAGCAGATCCGGACCAACAAGAGCAGTTCAAAAGAACCCAACATGCAAGGCTCCCACAATAAATCAAGAAACTTTACAGACCTATTGTGTGGAAGATACTCCCATTTGTTTTTCACGTGGTAGCTCTTTATCGTCGTTGTCTTCAGAGGAGGATGAAATGGAGAGCTGTAAGCGTAATGTCAACTCGGCCAGTAACTACCCAACTTTACCTATATCAGAAAAACAATCCACTAATAATGTTGCAGCTGAC
C/T AACGCACATCTGAGAGCCAATCATCAGTCCATTATGTTCGCGCCAAGCCTCCACGACATCATTTAGGACATGGTGATGGTTCCAGGCATCATAAAACGGTGGAGTTTTCATCAGGGGCTAAATCACCTTCTAAAAGTGGTGCCCAAACACCTAAAAGTCCCCCTGAGCATTATGTACAGGAGACTCCTCTAATGTTCAGCAGATGCACTTCAGTCAGCTCCCTTGACAGTTTTGAGAGTCATTCCATTGCCAGTTCTGTGCAGAGTGAGCCATGCAGTGGGATGGTCAGTGGCATCATCAGTCCGAGTGACTTACCTGATAGTCCTGGACAAACAATGCCTCCAAGTCGCAGCAAGACACCACCACCTCCACCTCCGCGGTCCACGTCAGTAAAACAGAAAGTTACAGTGCCACCCCACACTGAAAAACATGATTTGGCGCCAAGACATGCAGTTGTAAGTGCTGCCGTGCAAAAAGTGCAAGTTTTGCCAGATAATGAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations