Genomic Feature

tit446

ID
ZDB-ALT-050621-6
Name
tit446
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 15: 20465677 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GTGTCTACAGAGGTGGATCTGAGCGCCATATCTTTATTGGACACCTTAAATGGGCCACCAGGAATAAGGAAGGCCTCCTTCTCTCTACCTAAAGTGGAGGTTGGGCTCAAAGAAATGCGATTATTGACAGAATCCAGGTTGTTTCGAACTGTGGTTGAGCTGGCTTTGTGGTTCTGACGCATCTGTCGCAGGACCACAATGGCAGCACAGATCACTAAGGTTAGAGTAATGAGGCCTAGAGTAAATGAGACTATTAAGGCTGCTGGAAGAGCAGGGCTGTTCACAGGCGTGGGCTTCTGTTTGTACTCGCACTGTGTGCCCATGAAGCCTGCCGGGCACTGGCAGACAGGCCCAGAGAAGTGAGTGTAGCAGGTTCCTCCGTTCTGGCAGGGCATGAAACTGCAGGCGTCAGAGCGAACCCTACAGTCCTTGCCTGAGAAACCAAGCGTGCATGTGCAGGTGTACCCGTTGATACCATCCACGCAGGTGCCTGCATTTTG
A/T CAGGGGTTGCTTGAGCAGTCGTCAATGTTTGTTTCACAACGTGAGCCTGTGAACCCGGGCCGGCAACGGCACGTCGCTTTGTTGCCCAAATCGAGACACTGGCCACCTTTAAAAAAAATGCAGGGTGTTAACGTAATAAGCCTAAAATTTTGGAAAGTGAAATTGAATAATTAGGACAAAGGAGTACACCAGGGCAAGCAACCCTTGGGAAAGCAATGGTGCATGTTTTAGACTAATAAAGGTCTATTGCTTTATGACAGCTCTATCTCACCATATCAGTGTAAGAGTCTCACTGGCGTCTGTTCTATCATGCATGAGTAGTATGTCACGCACAGTTGACGAATCCCAAAACAAAAAAAGCTGAAGGATCAGCATGTTTCAAGAGGTGTAGATGGCTGGAATGAATTGCATTTAGGACTGAAAATAAGTGCAAAATATTCTCACCGTTAGCACAGGGGTCACTGCTGCACCGGTCGATTTTCTTCTCACAGTTGGAGCCC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations