Community Action Needed: Please respond to the NIH RFI
Genomic Feature

p50ada

ID
ZDB-ALT-030805-10
Name
p50ada
Synonyms
  • brb (1)
  • Brom bones (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Mullins Laboratory
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
p50ada is a C to T transversion , converting Gln 254 to a stop codon.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 26294385 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
p50ada is a C to T transversion , converting Gln 254 to a stop codon.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 254 (1)
Sequences
Flanking Sequence
ATGCGGTCCAGACAGGAGGCATGTCTTTGGCTGCTATTGATGGAGCAGGCATGGGGAGCCAGAGCCCTGTGCTGAGAGTTATTGTAGAAAATCTCTTCTATCCAGTCACTCTTGATGTCCTTCATCAGGTACTGACTGTCCTTCAGAAACCAAATTGAGTGTTTAAATGTATGCATATTTAATGTCTATGTAATGTTAATAGATTTAATTACTTAATGTTTAATTTATAATGTAAATATATTTTAATGTTGCCATTTAAATTGTTACCATTTTTTTCCCCATTTAGATCTTTTCAAAGTTTGGCACCGTTTTGAAGATCATAACCTTTACCAAAAACAACCAGTTTCAAGCTCTGGTTCAATACTCAGACGGAATGACAGCTCAGCATGCAAAGCTGGTGAGTGGCACAGTGGATCAATATATGAATGGATGAATGGGCAGCTAAATCCCTTCTGAACCTTGTAATCATTTGGCTTAACATTAAACAGTCTTTAGATGGA
C/T AGAACATCTACAATGCCTGCTGTACCCTTCGCATCAGTTTCTCTAAGCTCACCAGCCTGAATGTTAAGTACAACAATGATAAGAGCAGAGACTACACTCGCCCCGACCTGCCAACAGGAGACAGTCAGCCCTCCTTTGATGCACAGACAATGGCAGCAGCCGCCTTGAGTAAATTTGATTATTATTGCTGTAGTTAAATGATATACTTAACATATAAAATAACAAACTGCTTTCTCTCTCTTAGCTGCTCCTGGTATTATCTCTGCATCACCTTATGCTGGAGCTCATGGTTTCCCACAAGCATTTGCTATTCAGCAGGCAGCAGGTCAGTCATGGCTTTAATAGGGTCTTTTTTTTTTTCTTTTTTTTTTTTGGCATAATTCACAATGAGTCTGATCTTTAATTGCTGTTCCTTGTACACCTCTAAATCCAACACCAATTTTTTTGTGGGGGCTATGGGATCAGCCTCAACGGCCACTTGCCTTCCAAGGCACATCATC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations