Community Action Needed: Please respond to the NIH RFI
Genomic Feature

t22030

ID
ZDB-ALT-030715-2
Name
t22030
Synonyms
  • hx118 (1)
  • HX118FA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 5512370 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T at position 256 in GenBank:AY204859 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Glu>Stop at position 86 (1)
Sequences
Flanking Sequence
CGCTTGCTTCTCGAGTCATTTGAAGTTGTTTTTAGGCGCCGTGAAAGACGGTCATTTGAAGCGCTGCTCATTACTGTCAGTCCCACAGCAGTGGACCAATTAGAAGAGTTTGGAGGTGGAACTTCTGTTGCAACTTTCTGTTTACAGGCACTCTGTGGCTGTGTCCAGATGTTGTACGTGCTTTATGCTGCCCTATTTTTCCACAAACATTCTAAAATGTTTCATCCCGCTTTTTTAGAAGCAAATATTATTACCCTTGTGGTTTATGCTGTGCTTTTTTTACCTAACCATTCCGAACCATTGCGTCTCGTATTTTTAAGCAAAGATTCATTTCGTGTGAAAGAGCCTTTAACAGTCCTTCAAAATTAATCAGATATTTTCAAATGGGATGTGTGACAGTAAACCTACCTTTCCAATAATTTTGCCGTTCTTGTTCATACAGATGTAGTATCCGCTCTCCTGCCCTTTAATTCGAACGTGACTCCCGAAAGTCTCTGTCT
C/A CACCACAAGCAGAGCTGCAAAATACAAAAGACCAAAAATTAAAACACAGTTTGCAAAAAGGCACTGACATCAACATAACGCTCACAGAACTAAAACATTTTCTTCAATTTCATAACAATCATTTGTGACAATTAAGCACATTTTTGACAAAGTTGAAAAAAACCTACATGTAATAAAATCTACATGGTTTAATGATAAAATAAATAATAAAAATGTACATGTATTATTTCAAGTATACTTGATTTCAAATTCATGTATTTATTGTAGTCTTATTTATTATTTTTATATTCTTATTTTTGTGTAAGAAAAAACAGCAAACACATAAATTAAAAGTAACTTATTTACTTTTCAATAAAATACATTTTTAAATTAAATTAAATGAAACAATTAACTGTAAATTACACTTATATTTTTTTAAATGAATGCCAAATAGATATATTTTTTCTTTTGCATTTGCAGTGAAATATGACTTAATACATTTGAATAAAACATTTGAATAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations