Genomic Feature

j4blue

ID
ZDB-ALT-001205-16
Name
j4blue
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
Lab of Origin
Stephen L. Johnson Lab
Current Source
Other Pages
Note
A 5 nucleotide deletion near the middle of the 2nd kinase domain leads to 32 novel amino acids and a premature stop codon.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 3153746 - 3153750 (GRCz11) (1) Details
Nucleotide change
CACAG/-
Variant Notes
A 5 nucleotide deletion near the middle of the 2nd kinase domain leads to 32  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted from position 2648 to 2652 in GenBank:AF240639 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TTTTTTTAAATTGCATTGAACAACACCCCCCGCCATTTATTTTTATGACCAGTGTTGCTAAAAAAATTTAATAATTACTTTCATATAAAAATTAACATAAAATTACCTCTGATAAAAGCATTTGTCAAATGCTTAACAATTCAACTTGCATCCAATGGTATTATTAATACAATTTTTTACGCATAACAACTTGTACAATCTCATTCAAATGAAGGTGTGTGTTTTTAAGAAAGCCCCTCTCGCAAAAATAACCATCATTGATGCAAGAGCAGAATATACAAAGAGGAACAAATAACATAATACAAAATTCCACTATGCGCCACTAATTCAAGAAAATACAGCACAGGAATTGTCATGTGACTGCGTTGGCCCATTCAGCAGCATCTTTACATGCATGGAAATGAGAAGCAGACAAACCTTTCTGACAACTCAAAAAACTAAATCAGAGCTTCTTTAACCTTTGCTGTTGTGTTCCTGACTCACCCAGTGAGAAAATCTCC
CACAG/- CATGATCCCGTAAGACCAGACGTCACTCTGAACCGTATAAACACACTCGAAAATGCTCTCTGGAGCCATCCACTTCACTGGGAGACGAGCCTGAAAACACACACACACACACACACACACATACATATGACACTGAACCACAAAACCAGTATGATGCTGCATGCATGTCATGATTTTGCCAAGTATGATGCAATCCTGGATTAACATCTATGTTGATCCTGGAACATCGAAATTTTGAAAATGTAATCCATAACTATTCCTTACAACAAAACTGTAAAATATTCTCAAAATCAGAGGTGGATAACAGTTGGACAACAATCATGTAGAAGTGCGTAAATCGGACTATCTGATCAAAGGGAAGGTTGCAATGGCAGCGCCCTCTCTTACGTAAAGACTAAGGTTAATATGAATATTAATGTGGTGTTAGTTTCCTCACGTTTCCTTTGACTACGTAGTTGGAGTCGTTCATGATGTCTCGAGCCAGTCCGAAGTCACAGATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations