Genomic Feature

m881

ID
ZDB-ALT-001107-2
Name
m881
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
A T-to-A transversion produces an aberrant spice acceptor site. This results in a 7 bp insertion that leads to a frame-shift and is predicted to produce a truncated protein.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 42204820 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
A T-to-A transversion produces an aberrant spice acceptor site. This results in  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Splicing Variant, Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CTCAAAATACAGTTTTGGGGAAAATGATTAGCCCTCATGTACAATATTTATCTTTTTCAAATATTTCACAAGTGATATTTAGTAAATTTAGAAAGTCTTATTTGTTTTATTTCGGCTAAATTAAAAGCAGTTTACATTTATTCAAATCATTTGAAGGTCAATATTATTAGCCCCCTTATTGTCTACAGAACAAACCACTGTTATACAATGACTTGTCTAATTCCAACTTCAACTGCGTCTCAATATGTATTGCGGGAAAATTTAATATTGCAAATATTGCCGTGTTTTTTGCCCGAATAGTTCAAACTAAATCACTTTTGAAGACTTTTTTTCTGCTCAGAGACTCACCCGTGTGTGGAGTTGCTGGGGCTCTCGCCATTGGGCTCCTGTTTGATGGCAGGCGACACAATGGCGGGGTGAGGGATGCCCGTCTGGTGGAGGCCGTGAGGAGGATGAGGAACCATGTGTGGAGAGAAACGGCTGGAGACCAGACTGCACAC
A/T TAAACAGAGACATTCACAGTCGGTTAGTGACTGATGGAACATGGTATTGAAGGTAAATGCAGAACAACACAATGATAGATAGATCTATAAATAGTTAAATAGATGGACGTAATAATATTCGTAATAATAATAATTGGATGGACAGAGGTGATAGCGAATGACTGAACAAGTGAAAAATACAGTCACTTGTATATTGGATGGATGGATAGATCTATAGATAATTGATAATCGATAGAGTTGTCAATTTCAGTGATAGATGGACAGACATAGATAGATCTAACAGACAGACAGATTGATAAAATGCTGGATGGATGAATTGGATGGACAGACATATTGGAGATGGATGATGTGAATTGGATGGATTGATGTGTTGAAATGGATGGATGGATTGAATTGGGTAGATGGATTTAATTGGATGGATTGAAAAGGATGGATGAATGGATGGATTGAATTAAATCGATGACTGGATTGAATTGGATGGATTGATGTGTTAAAATGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations