ZFIN ID: ZDB-ALT-001107-2
Genomic Feature: m881
Synonyms:
Affected Genomic Regions: tcf7l1a
Type: Point Mutation
Protocol:
Lab Of Origin: Driever Lab
Location: Chr 10: 42204820 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splicing Variant, Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CTCAAAATACAGTTTTGGGGAAAATGATTAGCCCTCATGTACAATATTTATCTTTTTCAAATATTTCACAAGTGATATTTAGTAAATTTAGAAAGTCTTATTTGTTTTATTTCGGCTAAATTAAAAGCAGTTTACATTTATTCAAATCATTTGAAGGTCAATATTATTAGCCCCCTTATTGTCTACAGAACAAACCACTGTTATACAATGACTTGTCTAATTCCAACTTCAACTGCGTCTCAATATGTATTGCGGGAAAATTTAATATTGCAAATATTGCCGTGTTTTTTGCCCGAATAGTTCAAACTAAATCACTTTTGAAGACTTTTTTTCTGCTCAGAGACTCACCCGTGTGTGGAGTTGCTGGGGCTCTCGCCATTGGGCTCCTGTTTGATGGCAGGCGACACAATGGCGGGGTGAGGGATGCCCGTCTGGTGGAGGCCGTGAGGAGGATGAGGAACCATGTGTGGAGAGAAACGGCTGGAGACCAGACTGCACAC
A/T
TAAACAGAGACATTCACAGTCGGTTAGTGACTGATGGAACATGGTATTGAAGGTAAATGCAGAACAACACAATGATAGATAGATCTATAAATAGTTAAATAGATGGACGTAATAATATTCGTAATAATAATAATTGGATGGACAGAGGTGATAGCGAATGACTGAACAAGTGAAAAATACAGTCACTTGTATATTGGATGGATGGATAGATCTATAGATAATTGATAATCGATAGAGTTGTCAATTTCAGTGATAGATGGACAGACATAGATAGATCTAACAGACAGACAGATTGATAAAATGCTGGATGGATGAATTGGATGGACAGACATATTGGAGATGGATGATGTGAATTGGATGGATTGATGTGTTGAAATGGATGGATGGATTGAATTGGGTAGATGGATTTAATTGGATGGATTGAAAAGGATGGATGAATGGATGGATTGAATTAAATCGATGACTGGATTGAATTGGATGGATTGATGTGTTAAAATGGA
(1)
NOTES
Comment Citation
A T-to-A transversion produces an aberrant spice acceptor site. This results in  ... Kim et al., 2000
OTHER m881 PAGES No links to external sites

CITATIONS  (21)