Genomic Feature

b641

ID
ZDB-ALT-000821-2
Name
b641
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Westerfield Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 4: 14973999 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Gly>Arg at position 242 (1)
Sequences
Flanking Sequence
TAGTGGAGTGAATCATGTATAAAGTTTAACAAATTTCAAGCATTGATAAATACAATAGACAAAAGAAAAACTAAATAAACACTGCTTTATGATATTCTGGGGAGTCTCTTACAGTATTCAGGTTCAAATACTGAATAGTAAATGTAAAACAACACACTAGTCTTCATTGCATAAATATTAAAAAATTATATCTTTGTTAAACTTACAAATGGTACAACTTCTTGTGCCTGAACGCTTTAAACTTCCTCTAACATTGCTCCAACATCACATTGTTCTATAAAGCAGTCATTTACATTGTTGTTGGGGAAACATTCGCCTGGCTGACTTCCTGGTTTCCAGTATTTTTGACAGAAAGTAGCTGAAGTTTTGGCCTGGAGATTCTAATATTGAACGTTGTTCCTTCTTACAATTTCCAACAGGCCACATTTCTTGCAGACTGGAAGAATTCCAACCGTTACCCCGCTGTGATCCTCTTTTACGTCAACGCCTGTTTCTTCATT
G/A GAAGTATTGGATGGCTCGCTCAATTCATGGATGGAGCCCGCAATGAGATAGTATGCAAAAGCGACAACACTATGCGACTTGGAGAGCCATCGTGAGTAAAAAATCCACCTTTCAAAAAAATTGAATAACAGTAAATTAGAGTTATACATTTTACAGTCAGCAAATTAATTATCATGGACAATACTAACAATATAATCAGTACTTACTCAATTTTTGGGATGCAAAAAACGATTTTCAAGAGGCTTGTTTTTCTTCTAGATCCACCGAGACGCTGTCATGCGTGATTATCTTCGTCATTGTGTATTACTCGCTTATGTCTGGAGTTATTTGGTTCGTTATGCTCACTTATGCCTGGCACACATCATTCAAAGCCCTTGGCACCACCCATCAGCCTCTGTCTGGAAAAACGTCCTATTTCCACTTGGTCACGTGGTCTATTCCTTTTATACTGACCGTTGCTATACTGGCCAATTCACAGGTGAGACAACTCTTACACTTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
b641.pdf
Citations