Transcript
dre-mir-430a-5-201
- ID
- ZDB-TSCRIPT-241211-596
- Name
- dre-mir-430a-5-201 Nomenclature History
- Previous Names
- None
- Transcript Type
- mRNA
- Annotation Status
- Annotation Method
- Ensembl
- Associated With Genes
- Strain
- TU
- Non Reference Strain
- Genome Resources
- RNA Central
- None
- Note
- None
Sequence
| ENSDART00000182794 [ ] (double-click sequence to select) | [Download] |
>tpe|ENSDART00000182794.1|gene_biotype:miRNA|ENSDARG00000115035.1 transcript_biotype:miRNA ncrna chromosome:GRCz11:4:28699035:28699116:1 GTCACTATCGGTACCCTCACAAAGGCACTGACTTGGATGC TGTAATTGGTAAGTGCTATTTGTTGGGGTAGTTTCAAGTG AC
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations