Transcript

mir430a-001

ID
ZDB-TSCRIPT-090929-23373
Name
mir430a-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0001423 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001423|ZDB-TSCRIPT-090929-23373 LoadedMicroRNAMature mir430a-001 miRNA 22bp
TAAGTGCTATTTGTTGGGGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations