Transcript

mir10965-1-002

ID
ZDB-TSCRIPT-220127-3
Name
mir10965-1-002
Previous Names
  • dre-miR-10965-1-3p (1)
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000006171 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000006171|ZDB-TSCRIPT-220127-3 CuratedMicroRNAMature mir10965-1-002 miRNA miRBASE 21 bp
ATAAAGAGGCTGTTTCTGAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations