Transcript

mir10965-1-001

ID
ZDB-TSCRIPT-220127-2
Name
mir10965-1-001
Previous Names
  • dre-miR-10965-1-5p (1)
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000006170 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000006170|ZDB-TSCRIPT-220127-2 CuratedMicroRNAMature mir10965-1-001 miRNA miRBASE 22 bp
AGTGGTGATGAAACTCAATGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations