Transcript

fahd2a-202

ID
ZDB-TSCRIPT-160112-667
Name
fahd2a-202
Previous Names
  • fahd2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062357 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062357|OTTDARG00000032629| CH73-306I9.1|OTTDARP00000048731 CH73-306I9.1-002 LG_none CU683877.8,FP101906.6 Danio rerio protein_coding NOVEL, 889 bp
TTCAGTCACGTGACAGCGGTGCTGGAATGACAGTGAGCTA
CAGTATCAAAGTACAAAGATTGTGTAATTTTTGTGGAATA
TATTGAGATGTGTGAGCGAGTAAGACATCAGTCCTCAGAC
AGATCACCTTTGTAAGCGTTATTTTTTTTTTAAAACGTGC
ACGATCAACACTTCTGTTTTGTGAACCAAGATCAGATGAG
ATTTCTGGCTGTCCCTCAGCTCACTTTGAGGAGACTCAAT
GCCGTGTTCTCCGCAGGCTCCGTCCGACGCTTCGGCAGGA
TGAGACTTGTCCAGTTCTGCCATAAAGTTGCTGAGGGGAT
TGTGCGGGTCGGGGTGGAGCAGGATGAAGGTCAGGGGATC
GTTGATCTGAAAGCTTTTGACCCCTCCATGCCCTCCACTA
TGAGGGAGTTTCTGGAATTGGGGCCAAAGGGAATGGACTG
TGCTAAGAGGGCTTTGTCCAGTGGTCAGAATGTGCTGCCG
CGGTCAGACATCAGACTGCTCTCTCCAGTGACCAATCCAG
AGAAAGTGGTCTGTGTTGGTATGAATTACAAAGACCACTG
TCTAGAGCAAAACGCCCCCATTCCTAAAGAGCCCATCATA
TTCAGCAAGTTCCCCTGCTCCATCACCGGCCCTAATGATG
ACATCATTCTGCCAGACGAGAGTCAGGAAGTGGACTGGGA
GGTGGAACTCGCCTTTGTGATTGGCCGGAAAGGGAAGCAT
ATAAAGGAAGAAGAAGCCCTATCCTATATTGCAGGTTTCA
CTGTAGCGAATGATGTGAGTGCTCGTGATTGGCAGATGAA
GCGTAACGGAAAGCAGTGGCTGCTGGGAAAAACATTTGAC
ACGTTTTGTCCGCTCGGCCCAGCGCTGGTTACTACTGATT
CTCTGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations