Transcript

fahd2a-201

ID
ZDB-TSCRIPT-091203-160
Name
fahd2a-201
Previous Names
  • fahd2a-001
  • ch73-306i9.1-001
  • zgc:85683-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045617 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045617|OTTDARG00000032629|ZDB-GENE-040426-2499 fahd2a|OTTDARP00000036014 CH73-306I9.1-001 LG_none CU683877.8,FP101906.6 Danio rerio protein_coding NOVEL, 1583 bp
GTCACGTGACAGCGGTGCTGGAATGACAGTGAGCTACAGT
ATCAAAGTACAAAGATTGTGTAATTTTTGTGGAATATATT
GAGATGTGTGAGCGAGTAAGACATCAGTCCTCAGACAGAT
CACCTTTGTAAGCGTTATTTTTTTTTTAAAACGTGCACGA
TCAACACTTCTGTTTTGTGAACCAAGATCAGGCTCCGTCC
GACGCTTCGGCAGGATGAGACTTGTCCAGTTCTGCCATAA
AGTTGCTGAGGGGATTGTGCGGGTCGGGGTGGAGCAGGAT
GAAGGTCAGGGGATCGTTGATCTGAAAGCTTTTGACCCCT
CCATGCCCTCCACTATGAGGGAGTTTCTGGAATTGGGGCC
AAAGGGAATGGACTGTGCTAAGAGGGCTTTGTCCAGTGGT
CAGAATGTGCTGCCGCGGTCAGACATCAGACTGCTCTCTC
CAGTGACCAATCCAGAGAAAGTGGTCTGTGTTGGTATGAA
TTACAAAGACCACTGTCTAGAGCAAAACGCCCCCATTCCT
AAAGAGCCCATCATATTCAGCAAGTTCCCCTGCTCCATCA
CCGGCCCTAATGATGACATCATTCTGCCAGACGAGAGTCA
GGAAGTGGACTGGGAGGTGGAACTCGCCTTTGTGATTGGC
CGGAAAGGGAAGCATATAAAGGAAGAAGAAGCCCTATCCT
ATATTGCAGGTTTCACTGTAGCGAATGATGTGAGTGCTCG
TGATTGGCAGATGAAGCGTAACGGAAAGCAGTGGCTGCTG
GGAAAAACATTTGACACGTTTTGTCCGCTCGGCCCAGCGC
TGGTTACTACTGATTCTCTGAAAGATGTTCATAAGCTGGG
CATTCGCTGTTTCGTGAACGGAGCCACAGTTCAGGAAAGC
AACACCAATCAAATGATCTTCCAGACGGAGAAGGTGGTGG
CCTGGGTCTCACAGTTTGTGACTCTTTATCCCGGTGATGT
GTTTTTGACCGGAACCCCTCCAGGTGTGGGAGTGTTCAGA
AATCCACCTGTGTTTCTAAAGAAAGGAGATGTCGTGGAGT
GTCAGATTGATGAGATCGGATCGATACGCAACACAGTCGT
GTAACGGCGAGATCTTCTACATTGACTGAAGTGCCACTGC
TGTATCCTTAGCTAATTAATTAGAACATAAAACATGGATT
TTTTTCTTTCTTTTTTTAGCTGGAAGACATAAAATAAACA
TGCTCTGGCCCACTTCTTAAACAAAAACTTTCTATAATGC
AGCATTTCATTCGTTCTTCATTTTTCTCTGCCTGTCACTG
AATCAGCACACATGTATTTTTCATATATTTCATGTGGTTT
GTCAAACTGAAGTTTTCATGCAGTAAATTAAGCGAACGTC
TGATTATTTTTACCAGTAGATGGCATTACTGAGCTGTGTA
CAGTATAGCTGGTGTTACGTCTAGCTCATGTTTATCACTT
CCCAGCTTGAAATACAGTAGATTGTGTGTTAAATTACACT
CAATCGTGACTATTAAACATGCTGGATTATTATGGAAAAT
CTTTCAAATGTGATTTTTATTATCTATACAGTTGATTAAA
ATGAATCAATTTATAAATAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations