Transcript

gpm6aa-002

ID
ZDB-TSCRIPT-160112-494
Name
gpm6aa-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062804 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062804|OTTDARG00000021246| gpm6aa|no_translation gpm6aa-002 LG_ BX510944.11 Danio rerio protein_coding KNOWN, 745 bp
GTTCAAGGAGCGGACTTTAAACCCACAGGCACAACACTGG
TCACCGCCGTCGAGACCCCCGAAATCACAGGACAAGGCAA
CATGGAGGAGGACATGGATGAGGGACAGACCCAGAAGGGA
TGTATGGAGTGCTGTCTGAAATGTCTAGGAGGAATCCCTT
ACCCATCGCTGATTGCCACTATACTGCTGTATGCTGGAGT
AGCTCTCTTCTGTGGATGTGGACACGAAGCTCTCTCTGGA
ACGGTCACCATCCTCCAGAACTACTTTGAGGTGATCAGGG
GACCTGGAGATGGTCTGGATGTGTTTACCATGTAAGTGAC
AGCAGCACATTTAACTAGCTATTTTATATAGATCTTCAGA
TATATGCATTTTTAATACATAAATACCTTGCCGTAAAAGA
TCACATTTATAAGTTATAAACAGTGTTGGGGTATTGCATT
ACAAGTAATGTGAATTACGTAATAATACTACTTTTCCAAG
TAACGGGTAAAGTAAGGCATTACTTTTAAAATGTTAAATA
GTTATATTAGAGTTACTTTTTTAGAAATGCAATGTGAGTT
ACTTTTTAGTTCAGTTATTTTACTTATAAAAAAACAAATA
GCTGAATCAAAATTAGGTTAGTCATGTTGAATCCAGCACT
CAATGAGAGAATGCAGGATCAGACAGAATTGAAGATGGCT
GAGCCTTACATTTCTGCAATGGAAAATTCACATTATTTTG
AACATATGGAAGGAAAAGAGGATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations