Transcript

gpm6aa-201

ID
ZDB-TSCRIPT-090929-9528
Name
gpm6aa-201
Previous Names
  • gpm6aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026937 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026937|OTTDARG00000021246|ZDB-GENE-030710-7 gpm6aa|OTTDARP00000022080 gpm6aa-001 LG_ BX510944.11 Danio rerio protein_coding KNOWN, 4714 bp
TAACACTCAATGGTTTGCACAAGCCTGCACTGAGATGCCA
CACTGAACCTCCTCACACAAGGCAAGTGAACTGAAAAAAA
TGTGTGTTGACAGCAGCTCTTCTCTGTGAGGAACAGGGTA
GTAGCAGGAGCGAGAGAGGGAGGAGGGAGTGAGAGAAAGA
GAGAGCGAGAGAGAAAGAGAGAGAGAGACCAGCCTCAGCT
TCTATTGTGGAAAGCAGGCAAGAGAAAGGCGTTCAAGGAG
CGGACTTTAAACCCACAGGCACAACACTGGTCACCGCCGT
CGAGACCCCCGAAATCACAGGACAAGGCAACATGGAGGAG
GACATGGATGAGGGACAGACCCAGAAGGGATGTATGGAGT
GCTGTCTGAAATGTCTAGGAGGAATCCCTTACCCATCGCT
GATTGCCACTATACTGCTGTATGCTGGAGTAGCTCTCTTC
TGTGGATGTGGACACGAAGCTCTCTCTGGAACGGTCACCA
TCCTCCAGAACTACTTTGAGGTGATCAGGGGACCTGGAGA
TGGTCTGGATGTGTTTACCATCATTGACATCATCAAGTAT
GTGATCTACGGCATTGCTTCAGCTTTCTTCGTCTACGGTA
TTCTTCTGATGGTGGAAGGCTTCTTCACCAGTGGAGCCAT
TAAGGACCTGTATGGAGACTTCAAGATCACCACCTGCGGA
CGCTGCGTCAGTGCATGGTTCATCATGCTGACGTACATCT
TCATGTTGGCTTGGCTTGGTGTGACAGCATTCACCTCTTT
GCCTGTCTTCATATATTTCAACATCTGGACCATTTGCCAA
AACACCACTGTTCTGCAGGGAGCGAGTTTATGTCTTGACC
CGCGCCAGTTCGGTGTTGTGCCCATCGGAGAGGAGAAGAC
TTTATGCGTAGGATCAGAAAACTTCTTCAAAATGTGTGAA
TCAAATGAGCTGGACATGACCTTCCATCTGTTTGTGTGTG
CGTTGGCTGGAGCCGGAGCAGCAGTCATTGCCATGATCCA
CTACCTGATGGTTCTGTCTGCCAACTGGGCCTATGTGAAG
GATGCGTGTAAAATGCAGAAATACGAGGATTGCAAGTCCA
AGGAGGAGCAGGAGCTGCATGACATCCACTCCACACGCTC
CAAGGAACGGCTCAATGCCTACACATAAGACAGGAAGCAG
CAGCGAGGCGAGAGGACCCTCAGTGCTGTCACTTCCTGTT
GAGGGAGTTTTGGCACTGGTAAAGTCCAGGTGGTGTGTCG
TATGACCAACCCCATGGCCAACCCATTACCTCTCGCACAA
ACATTATTATTATTATTATTATTATTATGATTATTATTAT
TAGTGATAGAAGTAGTGTTGTAGTTTTTTCACATTGTTGT
GTTTCATTTTTTTCAAGAATCTGTGCAGGTTCGGTTCCAC
GACATGTTGCAATTTTTTCAAAATATTTCTCTTTTTAAAC
TCTTTTTAAGCATCGATACATCAATCATTCTTATGTAGAG
GGTCGGTTATTGGGGTGAAAAAAAGCACATTTTTCATGTG
TGTCTGTCTCATTATTAAGGACTTAAAAGCATGAAAAAAA
AAAGAAATTTTGGTAAAAATGAAATGAATAATTCTTTCTT
TCTCTTTCTCTCTCTCTCTCTCTCTCTTTCTATCATTAAT
TTTTTTAATCATCAAAAGGTATAGAGCCTGATACCAGCAG
ATGACCTGCTCATTCTGCGTTATTTTGGTAAAAGAAAACT
CAAAAAACTGAGGCAGAAAAGACAAAAAACAAAATTAAGA
TATAACAGATGTACCATAAAGTGTTTATTTATTATTTTTC
TACAGATGTCATTGCATAGCTTATCAAGATGATTACAAGA
TGACAGAATGGTTATTATTTGCTTGCCGTGCTAATTCAGA
CACGCATAGTCCCAGTAGGTGGCATTGTAACTGCTCTGAG
AGGGAGAGCAACCTTCTTACTACTTTTTGATAGATGGTGA
AGTCCAAAGTATACAGAGTTTGTTTTGAACACATTTGTTA
GAATGCAAAATTGCTGCCTTTCAAAGTGTACTCCATTTGA
CAGTGTACCCAAACACAGGTGCTTTATCACTGGTAAAATG
AATTTGAACGCGTTTAAATTAGTGTGTATCTTCAGATGAT
ACACTTGTCAACACTAGTGTCCATTGTTTTTGCAGTCTCA
GTAGTTTGCTGGTGTTGTTTATTATGTATATCCCCTCTCA
CAAGCACTTGTCGATGTTGGCGTGAGTTGTTTATTCCGCC
CTTCAGTAGTTTGCTGGGGTTTTTTTCTGACCGTGAATCA
ACAGCCCAGTTCAATGTTGACACCTTGTGGACAAACTAGG
TAGTGCAAAAACAATTCAAAGCACATGTGAGTGCATTGTC
ACATTTGCTGTACATGTAAAAAGTGAAGTATACTTTGGGA
TTAAGCCCTTTTCTGCATTCTATTCCATCACAGCTTTCGA
AGTATTAGCTACACTTGCGTCATCTCAAAACTACCATAAT
TTCGAGACTATGACATGCTATCCTGAGCTGTTCACACATT
CACAGACTTGGAATTATGCATTTTTTATGACAGCTTTATT
AAAGCCTAACCAAACTCAAATCTTTGGCATAGCATGTTCG
TTATAGCACTTAAGACGTAAGCGCTTTCTTGTGAACTCGT
TCTGTCTCTGCATTCGCCATCTGTGTGGTCAAACAAAAAT
AAAAGAGACAAAGTCATCTAATAATAAAAATGACATCACT
TTGACTGGAAATGAAGATGGCTGAAGTATACTTTGGGCTT
TAAGCATTAAATTAAGCCCAATCTCACTGGAAAACGTACC
TATTTTACGTATTGCCAAAAAGGTGGCTAATTCGTACAAT
GTCCATTCTTTAAAAGGTACGATTTTTTTCCAAATAACGC
TCACTCCTAACTACTAACTCATTAGGAGCGTGACTAAATT
GTATTAAAACATACAAGTTGGCATTGTAAGAATTAGCCAG
TAAAGTAAAATAGTTACGAATTGCTACAGAATTGCGCTGT
TTATTTATTTAAATCGTACAATAGTATGAACGACCCCCTC
TCTCTTCGGCAAACAATGCAACTCCCCCTTAACTGGAAGC
AAGCGACACAAGCACAAGCCTACAGCGTTATAACCCCCTC
TTTTTTATTTTCCTATACAAATAGATATAGACACAGGGTT
TGTTTGTTTTTATATGACGCGTTTTATTTCCAGCTTTTGT
ACATAGTCATTCTGTAAATGTATGTACTGTACGTTAGCAC
TTAAAAACTTCAGGTGAATTCGTAATGGATTAAAAAGAAT
AAAACACACATTCCATGATGGGATAGGATGGGAGGGGGGG
CGGAGGGAGGGTGTTCTTCTTAAAACCTAAGAAAAATAAT
GTTAAAAAAGACCAAGGAGAAGCGAGGCTATCGTGAACAG
ATCACTGGGCTGTTTTCTTTCCAAAGGAGGAAATGTGAGG
ATGAAAAGGAATATTTAAAGAGCTTATACTACTATTATCT
CGATGACAGTTACTCGTTGTCTTGCTAACAAGTCATTATT
ATATCGGACGATGGAGACGTCTTCTCTTTCTTTTAATGCC
TGGCAAGTCATGTTCTGTCAGTGTTTCTAAGAGCTAGTTT
TGTGCACTTATTTGACCATTTTGTGAGCTCTTTCTTGGTG
TAAGTGCATCGGGGCGCCGGCTTTGTCAAGTCAGACCCCT
GTAATGTTAGGTAAAGACTGTGAACCTAAGTGTTATTTGT
GGCATGGTCATGCATTCAATGGTAATCGTTTTACTGGATC
AAAAAATAAATAAATAATAATGATGATAATAATAATAATG
GAGAAAAAAAAATCAAAAGAAGAAAAAAAAAAACAAGATA
AACAGTTTTCATTTCATCTTTTTATGAGTTTGTTCTATGC
GACTGTCTTGCTGGGTCATCCCCTTCCTCATAACGTGCAG
TAATTTGAATCCTACGCTGAAAAAACATTGCGCTGAAACT
CCTACTCTTCGATGGTAGTGTTTGATTTGTGCCTGTTTAC
TTTGTGGTGATCTCTCTAACTCCTCCTCTCACCTTTCTAT
TACTATTGCTTGTTGAGCCCCTGACTTTAATGCTTTCTCT
GAACCCTCACCTCTCTCTCTCTCTCTCTCTCTCTCTCTAT
CTCTTACTCTGGCTCACTCTCCCTGTCCTCGTATACTAGT
CTTTTTTGTACTCTCACTAAAGAATGCTTAGTAGCAAGCT
GTACCATTAATTTGTTTTGTACATAAATGTGCCAACCGCT
TGACAGTGGCTTTTCTGATCTGTAGGGACAAACTGCTTGC
ATAAATAAACTACACTGGTGTACTTGTTAATAAATACTCG
ACGGTGGTTGTTGTTCTTAATGGTCTGTGTAGCATGTTTG
GTGTTATTCACTTCACTTCATACACGCTAAACTCTTTACG
GCAGTTCACTTTAATAGAACAAAATGGGTTTGCGCAAGTA
ATAAGTAAAAAAGAGCTGTTTATGTTTTATTATATATTAT
GTGTCATATTTTTCTGTATATGGCAAAACAACCATCATCT
TCAGTGTCATATGATGCTTTGGAAATAATTTCAGCATGCC
ATTTTATTGATTATTTTAATTTATTTATTTTATGATAATT
TATTTTTTAACTGTATTTTTTGATGAATAGAAAGTTCAGA
AGAACTAATAAAAACAAAAGGGAATCAGATTGACTGTATG
TATCCTTGTGGAACAATAAAATAATTAAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations