Transcript

mib1-202

ID
ZDB-TSCRIPT-160112-16
Name
mib1-202
Previous Names
  • mib1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062304 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062304|OTTDARG00000019100| mib|OTTDARP00000048693 mib-004 LG_none 1 32103 CU681854.5,CABZ01065400.1,CABZ01065399.1,CABZ01065398.1,BX842700.35 Danio rerio protein_coding KNOWN, 3227 bp
TCTCAAAGCTGGCTGAACCGCCAGCTAAAAGTAACTTAAA
TCGCAACTTTTGCTCGTAAATGACCACCGGCAGGAATAAC
CGAGTGATGATGGAAGGAGTGGGTGCTCGAGTTATCCGCG
GGCCTGACTGGAAGTGGGGGAAGCAGGACGGCGGAGAAGG
GCATGTGGGCACCGTCAGGAGCTTCGAGAGCCCGGAGGAG
GTGGTGGTGGTGTGGGATAACGGCACCGCCGCCAATTACC
GCTGCTCCGGGGCTTATGATGTGAGGATATTGGACAGTGC
GCCTACAGGAATCAAGCATGATGGCACCATGTGTGACACC
TGTCGGCAGCAGCCCATCATTGGAATCCGATGGAAATGTG
CAGAGTGCACCAACTACGACCTCTGTACCACCTGTTACCA
TGGCGACAAGCACCACCTGCGCCACAGGTTTTACCGCATC
ACCACCCCTGGCAGTGAAAGAGTTCTTCTGGAGTCTCGTC
GCAAGTCGAAGAAGATCACAGCCCGCGGCATCTTTGCAGG
AGGACGAGTGGTGCGAGGGGTGGATTGGCAATGGGAGGAT
CAGGATGGCGGGAATGGAAGAAGAGGGAAGGTGACGGAGA
TCCAGGACTGGAGTGCTGCCAGCCCCCACAGCGCAGCCTA
CGTCCTTTGGGACAACGGGGCCAAGAACCTCTACCGAGTG
GGATTCGAGGGCATGTCTGATTTGAAATGTGTGCAAGATG
CCAAAGGAGGGACTTTTTACAGAGACCACTGTCCAGTATT
GGGTGAGCAGAACGGCAACAGGAACCCAGGAGGCCTGCAG
ATCGGAGACTTGGTCAACATTGATTTGGACCTGGAGATCG
TTCAGTCACTGCAGCATGGGCATGGAGGATGGACCGACGG
CATGTTCGAGACGCTCACCACCACAGGCACTGTCTGCGGC
ATCGATGAAGACCACGACATTGTTGTGCAGTATCCTAGCG
GAAACAGGTGGACGTTTAACCCAGCGGTGCTGACCAAGGC
AAATGTTGTCCGCAGTGGAGAAGTGGCAGCTGGCGCTGAG
GGCGGCAGCTCGCAGTTCATGGTGGGAGATTTAGTCCAGA
TCTGCTACGACATCGACCGCATCAAACTGCTCCAGAGAGG
ACACGGAGAGTGGGCCGAAGCCATGCTGCCAACCCTTGGA
AAGGTGGGCAGAGTGCAGCAGATTTACTCTGACAGTGACC
TGAAAGTGGAGGTGTGCGGGACGTCCTGGACATACAATCC
CGCTGCTGTCACTAAAGTGGCCCCTGCTGGATCTGCGGTT
ACTAATGCTTCTGGAGCAGTGTTGACAGAGAGTCCTTCTG
TGCCCGCAGAGCGCCTGTCTCAGCTCCTCAAGAAACTTTT
CGAGACGCAGGAGTCTGGAGACATTAACGAAGAGCTGGTG
AAGGCCGCAGCCAACGGTGACCTGGCCAAAGTAGAGGACA
TCCTGAAGAGACCCGATGTGGATGTGAACGGGCAGTGTGC
AGGACACACTGCCATGCAGGCGGCGAGTCAAAATGGCCAT
GTGGACGTCCTCAAACTGCTGCTGAAACATAGCGTGGATT
TGGAGGCGGAGGATAAGGATGGAGATCGAGCTGTCCATCA
CGCATCCTTCGGGGACGAGGGTTCGGTCATCGAGGTGCTT
CATCGAGGCGGTGCTGACCTGAACGCCAGAAACAAGCGCA
GACAGACGCCGCTGCACATCGCTGTCAACAAGGGCCATCT
GCAGGTGGTCAAGACTTTGCTTGACTTTGGCTGCCACCCC
AGTCTGCAGGACTCTGAGGGAGACACACCTCTGCATGATG
CCATCAGCAAGAAGCGGGATGACATGCTCTCTGTGCTCCT
GGAAGCAGGCGCAGACGTCACAATCACCAACAACAACGGT
TTCAATGCGCTCCACCATGCAGCACTGCGAGGGAACCCGA
GTGCCATGCGTGTGCTGCTTTCCAAACTGCCACGGCCATG
GATAGTGGACGAGAAGAAGGACGATGGCTACACCGCTCTT
CATCTGGCTGCGCTCAACAACCATGTGGAGGTGGCCGAGC
TACTAGTTCACCAGGGAAATGCCAATTTGGACGTCCAGAA
TGTTAACCAGCAGACGGCATTACACCTTGCAGTGGAGCGC
CAGCACACCCAGATAGTGCGACTTTTGGTAAGAGCCGAGG
CAAAGTTAGACGTTCAAGACAAGGACGGAGACACGCCACT
GCACGAGGCCCTGCGTCACCACACGCTGTCCCAGCTGCGC
CAACTTCAGGACATGCAGGACGTCAGCAAAGTGGAACCCT
GGGAGCCCTCCAAAAACACATTGATCATGGGACTGGGCAC
TCAGGGGGCTGAGAAGAAGAGCGCTGCCTCTATTGCTTGC
TTCCTGGCAGCCAACGGAGCTGACCTTACCATCCGTAATA
AGAAGGGCCAGTCCCCTCTGGACCTGTGTCCTGACCCCAG
CCTCTGCAAGGCCCTAGCTAAATGCCACAAAGAGAAGACA
AGCGGGCAGGTTGGCTCTCGAAGCCCGTCTCTAAACAGTA
ATAATGAGACTCTGGAGGAATGCATGGTGTGCTCGGATAT
GAAAAGAGACACTCTTTTTGGCCCCTGTGGTCATATCGCC
ACCTGCTCTCTCTGCTCGCCTCGTGTCAAGAAGTGTCTTA
TTTGCAAGGAACAGGTTCAGTCCAGAACTAAGATCGAGGA
GTGTGTAGTTTGCTCTGATAAAAAGGCAGCGGTGCTCTTC
CAGCCCTGTGGTCACATGTGCGCCTGTGAGAACTGTGCGA
GTCTGATGAAAAAGTGTGTGCAGTGTCGGGCCGTGGTGGA
GCGCCGCACCCCCTTCGTTCTGTGCTGTGGAGGGAAAGGT
ATGGAGGATGCCACTGATGATGAGGACCTTACAGGGGGCT
CTAACTCAATGGCAGGGGGGTCGCAGGATCTTCTCCAGCC
CAACAATCTGGCCCTAAGTTGGTCCAGTGGAAATATCCCA
GCCTTGCAGAGGGACAAAGACAACACTAATGTCAACGCAG
ATGTACAGAAGCTGCAACAGCAACTGCAGGATATCAAAGA
GCAGACTATGTGCCCGGTGTGTCTGGATCGTCTGAAGAAC
ATGATCTTCATGTGTGGCCACGGCACCTGTCAGCTGTGTG
GAGACCGCATGAGCGAGTGCCCGATCTGCCGCAAGGCCAT
CGAGCGCCGAATCCTGCTTTACTAGAGCGCCGCGTCTGTG
TGGTTCTCATAAGCACCTTCCCCGGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations