Transcript

ottdart00000022285

ID
ZDB-TSCRIPT-141209-81
Name
ottdart00000022285
Previous Names
  • hspa9b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022285 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022285|OTTDARG00000018384|ZDB-GENE-030828-12 hspa9|OTTDARP00000018681 hspa9b-001 LG_ BX000526.8 Danio rerio protein_coding KNOWN, 3287 bp
ATCGCACTGGTTCTACAGGAGCAGGGTTTGATCCATTACC
GAACATTTATTTGACTTTCGTCTGACGAAAAAACCTAACC
AAAGACTTTTTATCAACGTTCACTTAACAAATAAATAAGT
CAAATATGTTGTCTGTGTCGAGAACGGCAAGGTTAGTGAG
AAATGTGTCGTGCTCTCAGAAAACCTCCAGCGGTGTGTCA
GATCTCATCAAAAAGGCTTGTCTAAATGGATGGACACAGA
AAACTCTCCAGACTGCAGCCAGACGTCATTATGCGTCAGA
GGCTATCAGAGGAGCTGTCATTGGCATCGACTTGGGAACC
ACAAACTCCTGCGTGGCTGTGATGGATGGAAAAAATGCAA
AGGTTCTGGAAAATGCAGAGGGTGCAAGGACAACCCCATC
AGTGGTGGCTTTTACATCTGATGGAGAGCGGCTTGTAGGA
ATGCCAGCCAAACGTCAAGCTGTTACCAACCCCAACAATA
CTCTTTATGCTACAAAACGACTGATTGGACGGCGTTTTGA
CGACGCTGAAGTTCAAAAAGATTTAAAGAATGTGCCATAC
AAGATAGTCCGTGCCTCTAATGGTGATGCCTGGCTAGAAG
TCCACGGCAAAATGTACTCACCCAGTCAGGCTGGAGCATT
TATACTCATTAAGATGAAGGAAACTGCTGAAAGCTACTTG
GGCCAGTCAGTGAAGAATGCAGTTGTTACAGTACCAGCTT
ACTTCAATGACTCCCAGAGACAGGCAACTAAGGATGCTGG
ACAGATTGCAGGTTTAAATGTGCTCCGTGTCATTAATGAG
CCAACTGCTGCTGCTTTAGCCTATGGACTGGATAAGACTC
AAGACAAAATAATTGCTGTTTATGATCTTGGTGGTGGAAC
CTTTGACATCTCTGTTTTGGAGATCCAGAAGGGTGTTTTT
GAGGTGAAATCTACCAATGGAGACACCTTCTTGGGAGGAG
AAGATTTCGATCAGCACCTTCTCAGGCACATAGTCAAAGA
GTTCAAGAAAGAGTCTGGTGTGGATTTGATGAAAGACAAC
ATGGCACTGCAGAGGGTGAGAGAGGCAGCAGAGAAGGCAA
AGTGTGAACTGTCTTCCTCTTTGCAGACTGACATCAACCT
GCCATACCTGACAATGGATGCTTCAGGTCCTAAACACTTG
AACATGAAGCTCACACGGTCTCAGTTTGAAGGTATAGTGG
CAGATCTCATCCGCAGGACAGTCGCACCCTGTCAGAAGGC
TATGCAAGATGCTGAAGTCTCCAAAAGTGACATTGGCGAG
GTTTTACTAGTTGGCGGAATGACCCGAATGCCGAAGGTCC
AGCAGACAGTTCAGGATCTGTTTGGCCGTGCTCCCAGTAA
GTCTGTTAACCCAGATGAAGCTGTGGCCATTGGGGCAGCC
ATCCAGGGTGGAGTTCTTGCAGGGGATGTGACGGATGTGC
TCTTGTTGGATGTTACCCCACTGTCTCTTGGCATTGAGAC
TCTTGGAGGAGTCTTTACCAAACTCATCAACAGAAACACA
ACCATTCCTACCAAAAAAAGCCAGGTGTTCTCTACTGCGG
CTGATGGACAGACTCAAGTGGAGATTAAGGTTTGTCAAGG
AGAGCGAGAGATGGCTACAGACAACAAGGTTCTGGGACAG
TTCACTCTGGTTGGAATCCCTCCTGCTCCTCGTGGAGTTC
CACAGATTGAAGTTACCTTTGATATAGATGCTAATGGGAT
AGTACATGTCTCCGCTAAAGACAAGGGCACTGGCCGAGAG
CAACAAATTGTCATCCAGTCATCTGGTGGCTTAAGCAAAG
ATGACATTGAAAACATGGTCAAGAATGCTGAGAAGTATGC
GGAGGAGGACAGGAGAAGGAAGGACCGTGTTGAAGCAGTC
AACATGGCAGAGGGTATCGTTCATGACACCGAGTCAAAGA
TGGAGGAGTTTAAGGATCAGCTGCCAGCTGACGAGTGTAA
CAAATTGAAGGAGGAGATCAGTAAAGTACGAGAGCTTCTC
TCGCGAAAGGATACCGAGACAGGAGAGAACATAAAACAGG
CAGCCACAAGCCTGCAGCAAGCCTCACTCAAACTGTTTGA
GATGGCATATAAGAAGATGGCATCTGAAAGGGAAGGCAGC
AGTGGCTCAAGTTCATCAGGAGAAGCAGGAGAGAAGAAGG
AGGGTCAACAGTAAAGGCGGTGACCGTTGAGATTGTTTGT
GGAACTGAATGGCTTGGGAGCGTGAATTTGTTTTCCTGAG
CAGCGTATGCAGAATATTCTCAAACATACTGTGTTTTTGG
CAGTAATTTCTACAAAACTAAATTGTCGTTTTTCCTCATT
TACCTCCCTTACATTGTTTTACATTCATTTGTGTCTGCTG
TAAATCTGTATCAGTCTTGGAAAATAAATGTGCAGCATGT
TCGATTTGCCACCGTGGCTTCAAAAATCAGTGCAATACAT
GTTAGCTTGACAAAATACATGCTCTCACCGCAGGCATAAT
CCTATTGCCATTTAGAGATGCATTCCAGCCATTTGGCCTC
AGTGTTGTATGGAGTCCTGTTTTTGAGTTAATTATTTTTA
TTATTACTGAAAATGTGTGTGTTTTGACCTGATGGGGTGG
AATGCATGTCTGAATGGCTTTAGGGTGTATTTACAGTTAG
TTTATACTGAATACTTTAATACTTAAGTGTGGCTTAACTG
TTTCAAGAAAACAAAGTTTTATTATAATCACTAGAGTATC
TGTTCTATCAATTCTCCTTGAAAATGCATCGATTTCAAGC
TTGTGCCAGTCAGTTTGAGGTTGGGTATGAAACTATGAAT
AAACCTAGGTAGCGTGGAATTGATAGTCAAATTGTCAGTT
TGTTCATACAGATGCTAGTGCACATAAAGTACATTAGTAC
GTGTATGTTAGCTTGACATGTATAAACCTGTATCTCCAGA
CTAGATGATATTTAAAATGGATGCTCAAGCAAACAGGTTT
AATTTCATTTTAATCTATGTATTGCTGTTAATGACAATAG
TGATTTATTACAAGTCAGGCTGTCTTGAGTGAAGGATCAA
CTACTTATTGTCATTTCCTTGCTGCAAAATATAACACAAT
CCCATCTTCTCTGTGCTTTTTCTATATGACTTTCTGGTTC
ATTTAAAGAAAAATAAAAACTAACCACGGTTGCTCTGTAC
AAAAGCTGTTGTCTGTTTAAAAGAATTGTAAAATGTTCAA
AATGGAATTGAATGAATAGATGAGCCTAAAGTAAACTTCC
AATTCTGTCTTTTTTTTTTTATAATAAAATGTGTATTTAT
CAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations