Transcript

hspa9-201

ID
ZDB-TSCRIPT-090929-18100
Name
hspa9-201
Previous Names
  • hspa9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037700|OTTDARG00000027866|ZDB-GENE-030828-12 hspa9|OTTDARP00000030223 hspa9-001 LG_ BX927254.15 Danio rerio protein_coding KNOWN, 4421 bp
ATCGCACTGGGTCTACAGGAGCAGGGTTTGATCCATTACA
GAACATTTATTTGACTTTCGTCTGAGGAAAAAACCTAACC
AAAGACTTTTTATCAACGTTAACTTAACAAATAAATAAGT
CAAATATGTTGTCTGTGTCGAGAACGGCAAGGTTAGTGAG
AAATGTGTCGTGCTCTCAGAAAACCTCCAGCGGTGTGTCA
GATCTCATCAAAAAGGCTTGTCTAAATGGATGGACACAGA
AAACTCTCCAGACTGCAGCCAGACGTCATTATGCGTCAGA
GGCTATCAGAGGAGCTGTCATTGGCATCGACTTGGGAACC
ACAAACTCCTGCGTGGCTGTGATGGATGGAAAAAATGCAA
AGGTTCTGGAAAATGCAGAGGGTGCAAGGACAACCCCATC
AGTGGTGGCTTTTACATCTGATGGAGAGCGGCTTGTAGGA
ATGCCAGCCAAACGTCAAGCTGTTACCAACCCCAACAATA
CTCTTTATGCTACAAAACGACTGATTGGACGGCGTTTTGA
CGACGCTGAAGTTCAAAAAGATTTAAAGAATGTGCCATAC
AAGATAGTCCGTGCCTCTAATGGTGATGCCTGGCTAGAAG
TCCATGGCAAAATGTACTCACCCAGTCAGGCTGGAGCATT
TATACTCATTAAGATGAAGGAAACTGCTGAAAGCTACTTG
GGCCAGTCAGTGAAGAATGCAGTTGTTACAGTACCAGCTT
ACTTCAATGACTCCCAGAGACAGGCAACTAAGGATGCTGG
ACAGATTGCAGGTTTAAATGTGCTCCGTGTCATTAATGAG
CCAACTGCTGCTGCTTTAGCCTATGGACTGGATAAGACTC
AAGACAAAATAATTGCTGTTTATGATCTTGGTGGTGGAAC
CTTTGACATCTCTGTTTTGGAGATCCAGAAGGGTGTTTTT
GAGGTGAAATCTACCAATGGAGACACCTTCTTGGGAGGAG
AAGATTTCGATCAGCACCTTCTCAGGCACATAGTCAAAGA
GTTCAAGAAAGAGTCTGGTGTGGATTTGATGAAAGACAAC
ATGGCACTGCAGAGGGTGAGAGAGGCAGCAGAGAAGGCAA
AGTGTGAACTGTCTTCCTCTTTGCAGACTGACATCAACCT
GCCATACCTGACAATGGATGCTTCAGGTCCTAAACACTTG
AACATGAAGCTCACACGGTCTCAGTTTGAAGGTATAGTGG
CAGATCTCATCCGCAGGACAGTCGCACCCTGTCAGAAGGC
TATGCAAGATGCTGAAGTCTCCAAAAGTGACATTGGCGAG
GTTTTACTAGTTGGCGGAATGACCCGAATGCCGAAGGTCC
AGCAGACAGTTCAGGATCTGTTTGGCCGTGCTCCCAGTAA
GTCCGTTAACCCAGATGAAGCTGTGGCCATTGGGGCAGCC
ATACAGGGTGGAGTTCTTGCAGGGGATGTGACGGATGTGC
TCTTGTTGGATGTTACCCCACTGTCTCTTGGCATTGAGAC
TCTTGGAGGAGTCTTTACCAAACTCATCAACAGAAACACA
ACAATTCCTACCAAAAAAAGCCAGGTGTTCTCTACTGCGG
CTGATGGACAGACTCAAGTGGAGATTAAGGTTTGTCAAGG
AGAGCGAGAGATGGCTACAGACAACAAGGTTCTGGGACAG
TTCACTCTGGTTGGAATCCCTCCTGCTCCTCGTGGAGTTC
CACAGATTGAAGTTACCTTTGATATAGATGCTAATGGGAT
AGTACATGTCTCCGCTAAAGACAAGGGCACTGGCCGAGAG
CAACAAATTGTCATCCAGTCATCTGGTGGCTTAAGCAAAG
ATGACATTGAAAACATGGTCAAGAATGCTGAGAAGTATGC
GGAGGAGGACAGGAGAAGGAAGGACCGTGTTGAAGCAGTC
AACATGGCAGAGGGTATCGTTCATGACACCGAGTCAAAGA
TGGAGGAGTTTAAGGATCAGCTGCCAGCTGACGAGTGTAA
CAAATTGAAGGAGGAGATCAGTAAAGTACGAGAGCTTCTC
TCGCGAAAGGATACCGAGACAGGAGAGAACATAAAACAGG
CAGCCACAAGCCTGCAGCAAGCCTCACTCAAACTGTTTGA
GATGGCATATAAGAAGATGGCATCTGAAAGGGAAGGCAGC
AGTGGCTCAAGTTCATCAGGAGAAGCAGGAGAGAAGAAGG
AGGGTCAACAGTAAAGCCGATGACCGTTGAGATCGTTTGT
GGAACTGAATGGCTTGGGAGCGTGAATTTGTTTTCCTGAG
CAGCGCATGCAGAATATTCTCAAACATACTGTGTTTTTGG
CAGTAATTTCTACAAAACTAAATTGTCCTTTTCCTCATTT
ACCTCCCTTACATTGTTTTACATTCATTTGTGTCTGCTGT
AAATCTGTATCAGCCTTGGAAAATAATGTGCAGCATGTTC
GATTTGCCACCGTGGCTTCAAAAATCAGTGCAATACATGT
TAGCTTGACAAAATACATGCTCTCACCGCAGGCATAATCC
TATTGCCATTTAGAGATACATTCCAGCCATTTGGCCTCAG
TGTTGTATGGAGTCCTGTTTTTGAGTTAATTATTTTTATT
ATTACTGAAAATGTGTGTGTTGACCTGATGGGGTGGAATG
CATGTCTGAATGGCTTTAGGGTGTATTTACAGTTAGTTTA
TACTGAATACTTTAATACTTAAGTGTGGCTGAAGTGTTTC
AAGAAAACAAAGTTTTATTATAATCACTAGAGTATCTGTT
CTATCAATTCTCCTTAAATGCATCGATTTCAAGCTTGTGC
CAGTCAGTTTGAGGTTGGGTATGAAACTTGAATAAACCTA
GGTAGCGTGGAATTGATAGTCAAATTGTCAGTTTGTTCAT
ACAGTTACTAGTGCACATAAAGTACATTAGTACGTGTATG
TTAGCTTGACATGTATAAACCTGTATCTCCAGACTAGATG
ATATTTAAAATGGATGCTCAAGCAAACAGGTTTAATTTCA
TTTTAATCTATGTATTGCTGTTAATGACAATAGTGATTTA
TTACAAGTCAGGCTGTCTTGAGTGAAGGATCAACTACTTA
TTGTCATTTCCTTGCTGCAAAATATAACACAATCCCATCT
TCTCTGCTTTTTCTATATGACTTTCTGGTTCATTTAAAGA
AAAATAAAAACTAACCACGGTTGCTCTGTACAAAAGCTGT
TGTCTGTTTAAAAGAATTGTAAAATGTTCAAAACGGAATT
GAATGAATAGATGAGCCTAAAGTAAACTTCCAATTCTGTC
TTTTTTTTTATAATAAAATGTGTATTTATCAGCTGAGCTA
TGTTTGTAGTGGTGTGTCTTGTTCCCCCAGCACTACATTT
TGAATGCCTCTATAAATTATGGTACCTAATTAATGTCTTG
GAGTTGTATGGATTATGATCAAAATACCCAAGTGCAGCTT
ATATTTAACTTGCATGAATTAATTATTCACCAAACTGCAT
GTCTAAAACTCTTCACAAACGTTTGGAAATGAGAGTGTGG
ACCTAATGGGATACAGTGCATCTGGAAAGTATTCATAGCG
CTTCACTTTTCACATTTTTTTAATGTTACAGCCATATTTC
AAAATGGATTAAATTAATTTATTTCCTCAATTCTACACAC
ACTAGCCCATAATGAAATGATTACATGTACATAAGTATTC
TCAGCCTTTGCCTTGAAGCTCTAAATTGAGCTCAGGTACA
TTCTGTTTCAACTGATGTTTCTTGAGATGTTTCATCAGCT
TAATTGAAGTCGACCTGTGGTAAATTCAGTTGATTGGACA
TGATTTGAAAAGGCATACACCTGTCTATATAAGGTCCCAG
GGTTGACGGTGCATGTCAAAGCACAAACCAAGCTTTTTTT
TTTTTCTTTTTTTTTTTTGAAGAAATTTGCATTATTTTTA
CATTTTCTTTTTACAATCTCATGATTGTTATTTTTGTTTG
TATTGTGATGTAAAAGGGTTTTAGAAGTTATTACAACCTA
ACTCACCATTTCTGTTGCCAGCGAAACCAGCGAAAGAGAC
GTTTATAGATAAAATTAGTTTTTCTAATAAAAAAGATAGA
AATTACAAAAATTGAAAAGGTTGTCACTTTGCTTCCAGTA
ATATCTTGGAAAAAAATATTTAGTGATTTGAAATGGAGAA
AAAATTGTCTTTTAATCAAATTTTATTATAATAAACAATT
TTAAAAAAGCTTAATTCTAAAATTAATGTAAAAGGTTCAT
TTTGTCAATTTCATACAGGAACTTTATATTTTGGGATTGT
AATTATGCTGTACAATTATTTTAAACATATTGGCTCATTT
ATTAATGATAATACACTGCAAGATGTTACTTTTAAAGAAA
TTATTTTTGGTTTTGAATCTGCCTCTATTAATGCTTGTTT
TGTCATAAATTTAATGTATTTTCTTTAAAGTCCATATTCA
CAAATACAAATTTGCTAATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations