Transcript

ctsf-202

ID
ZDB-TSCRIPT-141209-683
Name
ctsf-202
Previous Names
  • ctsf-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060497 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060497|OTTDARG00000041971|ZDB-GENE-030131-9831 ctsf|OTTDARP00000046751 ctsf-001 LG_ FP102984.9 Danio rerio protein_coding KNOWN, 2884 bp
ATGCGGGGCGCCTCACACCGACTGACACTGTGCCGTGTGG
AGCATCAAAACACTGCGAGTTTATAATCTGAACACAAACC
TCTGCTGATCTGACGTCGCTGCTTTTTGTCCTGAAAGCTC
GACAACATGTACTTCAACCGCGGTTACACCGTCATCGCCT
GCTGGGTGTTGGTCGGGTTGGTTCTGGGTTTAGAAGATGG
CCCGGACCGCCCGGTTATCGGAGCTCCAGGATCGCCGGTC
CGTCTGTCGGATTCTGACCCGGGGGTTATGAAAGCAGTAA
AGTTCGCCGAGGAACGATATAATATGGGCTCCAACGCGAT
GCATATACGTCGTGTCAGCAAAATCCTTTCGGCCAGCAAA
CAGCTGGTGAAAGGTGTCCGGTACAGCATTATGGTGGAGA
TTGGGAGCACTCAGTGTAAGAAAGCTGCAGAACTGAGCAC
TGCGGACACCTGTGACTTCTTCCCAGAGCCTCACAAACAG
AAGACTGAGGTTTGTTTGTTCGAGGTTTGGGACATTCCCT
GGGAAAATAAATCCACGCTACTTAAACAGAAATGCCAGCC
TGCGGTTGTGAAGGAGCTCAAAAAGGTTGCGGCTGTACCT
CTAACCCACAGCAAACCAATGAAGGAAAGCGTGGAGCTTC
TGACCATGTTTAAAAACTTTATGATTACATACAACCGAAC
ATACAGCTCTCAAGAAGAGGCAGAGAAGCGTTTGCGCATT
TTCCAGCAGAATATGAAAACAGCACAGACGCTTCAGTCTC
TGGAACAGGGATCAGCTGAGTACGGCATCACCAAGTTCAG
CGACCTCACAGAGGATGAGTTCAGGATGATGTACCTCAAC
CCAATGCTGAGTCAGTGGAGTCTGAAGAAAGAGATGAAGC
CTGCAATTCCAGCCAGCGCACCCGCTCCTGACACCTGGGA
CTGGAGGGACCACGGAGCAGTCAGTCCTGTGAAGAATCAG
GGGATGTGTGGCTCTTGCTGGGCATTTTCTGTGACTGGAA
ACATCGAGGGACAGTGGTTTAAGAAAACTGGACAGCTGCT
TTCTCTTTCTGAGCAGGAATTGGTGGACTGTGATAAGCTG
GACCAGGCATGTGGAGGTGGGCTGCCATCTAACGCTTATG
AAGCCATCGAAAACCTTGGAGGTTTGGAGACTGAAACAGA
CTACAGCTACACTGGACACAAGCAGAGCTGTGATTTCTCC
ACAGGGAAAGTGGCCGCCTACATTAACAGCTCAGTGGAGC
TGCCCAAAGACGAGAAGGAGATTGCTGCTTTTCTGGCTGA
GAATGGTCCGGTGTCTGCTGCCCTTAACGCTTTTGCCATG
CAGTTCTACAGAAAAGGAGTTTCTCATCCTCTGAAGATCT
TTTGCAACCCGAGGATGATTGATCACGCTGTGCTGCTTGT
GGGATTCGGACAACGCAATGGCGTTCCTTTCTGGGCCATC
AAGAACAGCTGGGGAGAGGATTATGGAGAGCAGGGCTACT
ATTACCTGTATAGAGGATCCGGACTGTGTGGAATCCACAA
GATGTGCTCATCTGCAATTGTGAATTAGACACACACACAC
TTGTATACATGGTTTACAGGGACACTCCATACACATAATG
TATTTTATATAGTAAAAACACTTATTATATGATCCTACCC
CTATTCCCACAGGGACACAGGGCAATAAAGTAATAGCTCG
AGCCAGACAGAATCTGCGGATATTGTTTTGCAATTGTAAA
TAATGTGCAGATTTATGCGTAATGATTTTGGGAGTATCGT
AACTACATACTTAATTTCTGAAATAAAAATAATAACTGTT
TACTATGCCGATCCAATCAGATCCACTTACAGTATTTGGT
AAACAAAGCAAGTCTCTGATATTTCTACTAAAAGACAGAG
AATATTACATTGTAAACTGTGATAAATCATATAAACATGT
TTAAATTAGTCAATAATATTACTGAAATTAATTTAAAAAC
TGACTAAATATAAATGTACACACATTTAGCAAAGTAATAT
ATAATATGTGTACCCTAGTAAGGTAAAACCAGATTAATAG
AGTACAAATCAAGTCATTCCCATGTCATTATACAACGTTG
TGTCCCTGTAAACCTCATAAACCTGTACACACACATACAC
ACATACACTGAAATAGAGCATGGACACAAAGCATTTGAAA
AGTGTTCAGTCATGAACATGTGATGGTCCAATTCAGTACA
GAGTTCACAGATGTCATGTGATCTGTAAACACAACATTAA
AAACGCACATTCTGCACATATTTCATCCATAAAAGCACAT
TCTTCTCAATAACCCAAACATGTGAAGCATTTCTGTGTGC
TGTTTGCTGTTACCTGCTAAACATCGGTTGCATTCTCACA
CTATAGCCCGACTGACCGTACCTCAAACCCTCATGCGCAG
TGATGTTAAGGACACAGCAGAAAAACCAAATAGCTCAAAA
CTGACCGCACATCGTTTACCACGTTACTAATATAAGCGCT
GCACATGCTATTGTGATTTTTACTGTGTTTTACTCTGCTT
AGTTTTCATTGGTCTAATATTTAATTAAAACTCTTCATTT
TAACCCTGCTGAGTAGATTAGTGAATCATTTTAATGCATT
ATTATTATTATTATTAATCTTATTAAGCGATTGAACACTG
GATTTTTGTATTATCTATTGTGATCATTCCGTTAAATTTG
AGCAGGGCTGTTTTATCCCACTCATTTTCCTCATTTTTTG
ATCATATGTAGCTGCTGATTGTTCTTTCAAGTGGAAGATT
AGTTTGAAGTTTGTTGTGTTGTTAGAAATGCTTAATCATT
TTCTCATTTGTCGTACTGTTTAAACTGGCTGTAACTCTCA
TTGCAATTATATAGTGGAATTGCTGAATAAACAACCGAAC
GTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations