Transcript

ctsf-002

ID
ZDB-TSCRIPT-141209-1907
Name
ctsf-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060498 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060498|OTTDARG00000041971|ZDB-GENE-030131-9831 ctsf|no_translation ctsf-002 LG_ FP102984.9 Danio rerio protein_coding KNOWN, 857 bp
GACAGCTGCTTTCTCTTTCTGAGCAGGAATTGGTGGACTG
TGATAAGCTGGACCAGGCATGTGGAGGTGGGCTGCCATCT
AACGCTTATGAAGCCATCGAAAACCTTGGAGGTTTGGAGA
CTGAAACAGACTACAGCTACACTGGACACAAGCAGAGCTG
TGATTTCTCCACAGGGAAAGTGGCCGCCTACATTAACAGC
TCAGTGGAGCTGCCCAAAGACGAGAAGGAGATTGCTGCTT
TTCTGGCTGAGAATGGTCCGGTGTCTGCTGCCCTTAACGC
TTTTGCCATGCAGTTCTACAGAAAAGGAGTTTCTCATCCT
CTGAAGATCTTTTGCAACCCGAGGATGATTGATCACGCTG
TGCTGCTTGTGGGATTCGGACAACGTGAGTTACATTCACT
TAGGCCCCGTTTACACTAGTTCGTTTTAGTTTTAAAACGG
CGTTTTAGAATGAAAACGATCCGCGTCCACACTAGCGTTT
TACCCAGCGTTTCTGAACAGCTCTCTGTCCACACCGAAAC
ACGCACTCTGGCATGCGCTGCAGCCTATCTACCCAGATGA
GAGCTGTGTTTGTAGGATCTACCGCTGGATCTAATCTCAC
TATATTTGTTAAACGTGATATTTTAATCATCTTTATTTCT
ATATCTAACAACATTTACCCCGACTTTGGCTTTTTTAATC
TATTACTTGTTCTCAGGTAACGTGTTTTGGCTGAGCGCAA
AGATAAGTTAATAATTAATGTAACCACGTACATTCTGTAT
ATCGAGTAATTGCTTGCCTTTATTTCCTATAATGTATAAA
CTTATTGTACGTTACACTTTTATAAAGGCCATTATCGAAT
ATTAAAACTGATATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations