Transcript

sod3a-201

ID
ZDB-TSCRIPT-141209-3635
Name
sod3a-201
Previous Names
  • sod3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062179 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062179|OTTDARG00000042994|ZDB-GENE-050309-208 sod3a|OTTDARP00000048597 sod3a-001 LG_ CU651678.9 Danio rerio protein_coding NOVEL, 1125 bp
TTTATTTACCAAAGTACATTCTCCGAGTTCAGACGGATTA
AGCTTTGCTGTGATCTTGTGACTGAATTATTCAGCCTGTT
TCAGGACAACATTTCAGCTATAAGGCTTTAAAGTGCAACA
TGAAGAAACTCATCTCTGTCATATTACTGGCGCTTCACAT
ACAAAGAGGAGATTTTTCAGACAGTTCAGATTTTCATCTC
ATCGAAGCTCCAAAACCAGAAGTGTTTGAGTTTAACAACA
CAATCTACGCAACATGTGAAGTCTCTCCCATCCCAAATTT
ACCCGCCGGCCAGCCTGAGATCTTCGGCCAAGTCCTCTTC
AGGCAGGTTTTCCCCAACGGGACTGCAGAAGTCAAAATAA
ACCTGCGTGGATTTCCTGAAACTGATAATCAAGTGCGTGC
CATCCATATTCATCAATACGGAGACCTCAGTCAGGGCTGC
GTCACCGCCGGGCCACATTATAACCCGCAGGACGTCCCGC
ATCCTAATCATCCCGGAGATATGGGCAACTTCATGCCAAA
ACAAGGACTTATCCGGCGGTTTCTGAAGCTCCCAGAGGTC
AAGCTGTTTGGAGGTCAGTCCGTGCTGGGGCGTGCGGTGG
TGGTGCATGAGAAGGAGGACGATCTGGGAATGGGAGCAGA
TGAGGAGAGTAAACGCAGTGGGAATGCCGGGAGGAGAATC
GCTGGATGTGTTATTGGCATCACCAAGCCTCATCTGTGGC
AGAAAACTGAACACGTGGAGGAGGAAGAGAGTAAGAGATG
AGCGTCGAGGTGGATTGTGGATTATCATGTTTAGATTTAG
TTTTGAAAGAAGATGATCACTCTTTAAAGGGGACCTATTA
TGCAAAAATCACTTTTATAAGGGGTTTAAACACACTAGTG
TGTGAATATAACCACCTTCTAATAGTTAACATTGATTGAG
ACTATGTTTTGTAATCACACTTGATGTAAACAGTCTGCAG
AAACACTTTGATTGACATTCTCCGTTTGTACGTGTCATCA
GAGGGGGAATGCTCCGCCCACAGGTGACCATCCCTCATTA
ACATAGGACTTTAGTCTTGCTTGTGAATCTGCCACTATGC
TGACAGTCACACAGGAATTTGTAGCTCCGCCCTCATAAAA
AAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations