header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3492
Transcript Name: mrps27-201
Previous Name: ottdart00000061725

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061725 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061725|OTTDARG00000042723|ZDB-GENE-040808-39 mrps27|OTTDARP00000048276 mrps27-001 LG_ CT027631.14 Danio rerio protein_coding KNOWN, 1780 bp
AGACGTCAGTGTTCTCGGTGATGCTGATTCCCCCCATGAA
GTCCTACTGAATGGTTCAGTCCCAAGATGGCGACCTCCAT
CATGCAGCGCTGTCTGTTTCCACGACGGAGGTTTATCCAA
TGTATTGATTACAAATCAGTTGCCAGAAGATGTTTGCTGT
CGTCCGCATACACTAACGCCACAATATGGGAGCAGAGACA
AAAAGAGCCACACAGCCTGGGTCAGTTAGCTGCTCTGATG
GACCGAACGTATGAGAGAAAGCTGCCCGTCAGCTCCTTGG
CCATCGGCAGGTTCATAGATAATATATCATCCAGAGATGA
AGTGGATCAAGCAGAATATTACCTGTATAAGTTTCGTCAC
AGTCCAAACTGCTGGTTTCTCCGGGATTGGACCGTTCACA
GCTGGATTCGACAGTGTCTTAAATACGGAGCCAGAGATAA
AGCTCTTTACACGCTGAAGAACAAGGTTCAGTTCGGCATA
TTTCCTGATGACTTCACCTTTAATATTCTGATCGACTCCT
TTATAAAAGACAAAGACTTTAAAGGAGCGTGTTCAGTTGT
GGAGGAAGTGATGCTTCAGGAGTCGTTTGAGCAAATCTCC
ACACAGATTCTGTCTCTTCATGCTCTCAGCAAATATCTGG
CAACCCAACCTGAGCTCAGCTGGCAGGAGGAGAGGAGCAT
TGGAGCATCGCTGCTGCTGGCAGGACTGAAGCAGGAGAAC
TCCATTGGTTTCAGTGCGCGGCTAATGGGACTCGCTCTTA
TTGGTAAAGTGGAGTTCTCCAGAGGGATCCACGCTGTGTT
TCATGAGATGCCGCTGATCTGGAGCTCTGGTTATCTGCGC
CGCGCTGTCGCCGTCCTGCAGGCCGTGAGTTCAGACTTCA
CAGGCGTGCAGATCTCCGAGGACGCGTTGAATTTTATGGA
GAAAATCCTGCAAGATCTGTCAGCGATCTCTGATGGAGCA
AACACACAGAATGACAGCGAGATGCATCTGGACGAAGAAG
ACCAGCTGGAGAGACTCAAACTCCCACAATACATCAGCAG
CTTCAGGGAGCTGAAGGAGCGTCTGCAGACTCAGGATAAA
ATCGTCTCAAGGAGTCTGGAGTCTCTGCTGGAGCTCCTGC
CGATCAGTGAAGAGTCGGATTTATCTGCGTATCGGCAGCG
GATGCAGGACTGGGGAGACGAGCAGCAGAAACTCATCCAG
AGAGAAGCAGAGAGCAGAGAAAAGAGCAAACGGGACGCGC
ACACACTCAGAGCCGCGCAATGAAGAGATTGAGAGTGTGT
GTGTGTACACTGCAAACACTGCTTTGCTTACTGTGAGTTT
TTGTCTTGTTTCTAGTCCAAATATCTAAATATTCTTGAAG
CATTTTCTAGACAAGCAAAATAATGAAATAATGAGTCAAA
ATGAAGTGAGTTTTTCCTTAAAACAAGCACAATAATCTGC
CAATGGGGTGAGTAAAATAATAATGCTTTCAGTTTGACTG
AAGATTCATGAACTGACTCCCTTGGCAGATTATTTTGCTT
GTTTTAATGAAAAACTCTCTTCTTTTCGACTCATTATTTC
TGAAAATAAGACTATATTTGTTCTTCCTCTAGCAAATGCT
TCTTGGTTTAAGATTTTTTGAGATATTTAGACTAGAAACA
AGACGCAAACTCTAAATAAGAAAAGTCTTGTTCGGTGTGT
CATCATCGTCATGTAGGTTTGTGTGTTGATATTATCTGGT
GTCTTTATATCAGTAATCTGTAAATCTAAACAGCAGAAAT
AAACAATCAGAATACTTTTA

mrps27 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mrps27-201 1780
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrps27-201 Contained in:

OTHER mrps27-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061725 (1)
  • Ensembl_Trans:ENSDART00000092773 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC079488 (1) 1750 bp
    GenBank:EG575261 (1) 973 bp
    CITATIONS (2)