Transcript

mrps27-201

ID
ZDB-TSCRIPT-141209-3492
Name
mrps27-201
Previous Names
  • ottdart00000061725
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061725 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061725|OTTDARG00000042723|ZDB-GENE-040808-39 mrps27|OTTDARP00000048276 mrps27-001 LG_ CT027631.14 Danio rerio protein_coding KNOWN, 1780 bp
AGACGTCAGTGTTCTCGGTGATGCTGATTCCCCCCATGAA
GTCCTACTGAATGGTTCAGTCCCAAGATGGCGACCTCCAT
CATGCAGCGCTGTCTGTTTCCACGACGGAGGTTTATCCAA
TGTATTGATTACAAATCAGTTGCCAGAAGATGTTTGCTGT
CGTCCGCATACACTAACGCCACAATATGGGAGCAGAGACA
AAAAGAGCCACACAGCCTGGGTCAGTTAGCTGCTCTGATG
GACCGAACGTATGAGAGAAAGCTGCCCGTCAGCTCCTTGG
CCATCGGCAGGTTCATAGATAATATATCATCCAGAGATGA
AGTGGATCAAGCAGAATATTACCTGTATAAGTTTCGTCAC
AGTCCAAACTGCTGGTTTCTCCGGGATTGGACCGTTCACA
GCTGGATTCGACAGTGTCTTAAATACGGAGCCAGAGATAA
AGCTCTTTACACGCTGAAGAACAAGGTTCAGTTCGGCATA
TTTCCTGATGACTTCACCTTTAATATTCTGATCGACTCCT
TTATAAAAGACAAAGACTTTAAAGGAGCGTGTTCAGTTGT
GGAGGAAGTGATGCTTCAGGAGTCGTTTGAGCAAATCTCC
ACACAGATTCTGTCTCTTCATGCTCTCAGCAAATATCTGG
CAACCCAACCTGAGCTCAGCTGGCAGGAGGAGAGGAGCAT
TGGAGCATCGCTGCTGCTGGCAGGACTGAAGCAGGAGAAC
TCCATTGGTTTCAGTGCGCGGCTAATGGGACTCGCTCTTA
TTGGTAAAGTGGAGTTCTCCAGAGGGATCCACGCTGTGTT
TCATGAGATGCCGCTGATCTGGAGCTCTGGTTATCTGCGC
CGCGCTGTCGCCGTCCTGCAGGCCGTGAGTTCAGACTTCA
CAGGCGTGCAGATCTCCGAGGACGCGTTGAATTTTATGGA
GAAAATCCTGCAAGATCTGTCAGCGATCTCTGATGGAGCA
AACACACAGAATGACAGCGAGATGCATCTGGACGAAGAAG
ACCAGCTGGAGAGACTCAAACTCCCACAATACATCAGCAG
CTTCAGGGAGCTGAAGGAGCGTCTGCAGACTCAGGATAAA
ATCGTCTCAAGGAGTCTGGAGTCTCTGCTGGAGCTCCTGC
CGATCAGTGAAGAGTCGGATTTATCTGCGTATCGGCAGCG
GATGCAGGACTGGGGAGACGAGCAGCAGAAACTCATCCAG
AGAGAAGCAGAGAGCAGAGAAAAGAGCAAACGGGACGCGC
ACACACTCAGAGCCGCGCAATGAAGAGATTGAGAGTGTGT
GTGTGTACACTGCAAACACTGCTTTGCTTACTGTGAGTTT
TTGTCTTGTTTCTAGTCCAAATATCTAAATATTCTTGAAG
CATTTTCTAGACAAGCAAAATAATGAAATAATGAGTCAAA
ATGAAGTGAGTTTTTCCTTAAAACAAGCACAATAATCTGC
CAATGGGGTGAGTAAAATAATAATGCTTTCAGTTTGACTG
AAGATTCATGAACTGACTCCCTTGGCAGATTATTTTGCTT
GTTTTAATGAAAAACTCTCTTCTTTTCGACTCATTATTTC
TGAAAATAAGACTATATTTGTTCTTCCTCTAGCAAATGCT
TCTTGGTTTAAGATTTTTTGAGATATTTAGACTAGAAACA
AGACGCAAACTCTAAATAAGAAAAGTCTTGTTCGGTGTGT
CATCATCGTCATGTAGGTTTGTGTGTTGATATTATCTGGT
GTCTTTATATCAGTAATCTGTAAATCTAAACAGCAGAAAT
AAACAATCAGAATACTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations