header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3070
Transcript Name: bmp7a-202
Previous Name: bmp7a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060285 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060285|OTTDARG00000027635|ZDB-GENE-000208-25 bmp7a|OTTDARP00000046580 bmp7a-002 LG_none CR925817.13,CU633826.8 Danio rerio protein_coding KNOWN, 973 bp
ACACAAAGAGAGTCAAATCTTGAATTAGCAGGCCTGGGAT
AATCTCCCATCTACATTGATATTAGCAAGAGCCCTTCCCC
CAGGAAAAGTGGCTTGTGGTTGCAGTGTGCTCGCAGACGC
AATGCAAGCAAACTTCACCATGGATAATGACATTCAGTCC
AGCTTCATCCAGCGGCGCCTGAAGAGCCAGGAGCGCAGAG
AGATGCAGCGGGAAATCCTCTCTATCCTCGGGCTGCCGCA
ACGGCCACGTCCGCTCCTGCACGAGAGACACACCGCGGCT
CCCATGTACATGCTGGATCTGTATAACGCCATCCTGGAGG
ACGGAGACAGGCGCGGTGGGCTTGTGTACTCTTATGAACC
CGCGTACACGACCCCGGGACCCCCGCTGGTGACCCAGCAG
GACAGTCGCTTTCTCAGTGATGCCGACATGGTGATGAGCT
TTGCGAATACAGTGGATCCAGAAGAAGACCTTCAACTGTA
TCATCAGCATCGCAGAGAGTTCAGATTTGACCTTTCTCGC
ATCCCGCCAGGTGAAACTGTGACCGCTGCAGAGTTCCGAA
TCTACAAAGACTTTGTTCGCGAGCGTTATGAAAACGAGAC
CTTCCATGTCAGCGTGTTCCAGGTGCTTCAACAGCAGCAC
AGAAGGGAGCTGTACCTGCTGGACTCACGAGTGGTATGGG
CTGCAGAAGAGGGATGGCTGGTCTTTGACCTCACGGTCAC
CAGTAACCACTGGGTTATAAACCCAGGTCAGAACTTAGGA
CTGCAGCTCTTAGTGGAGACCTCACATGGTGCAAGAATGA
ACCCAAGAAGAGCTGGCCTGGTGGGCAGCAGTGGAGCTCA
GAATAAGCAGCCGTTTATGGTGGCGTTTTTGAAAGCATCA
GGAATCCACCTCCGCAGTGTCCGCTCGGCATCAGGAGGCA
AACAGAAGGGTCATCACCGCACAAAAAACGCCAAACCTGG
CGCTGCACACAGC

bmp7a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bmp7a-201 (1) 3384
bmp7a-202 973
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bmp7a-202 Contained in:
[Fosmid] CH1073-430F17 (1) (order this)
OTHER bmp7a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060285 (1)
  • Ensembl_Trans:ENSDART00000143942 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH446351 (1) 953bp
    GenBank:EH497482 (1) 916bp
    CITATIONS (2)