Community Action Needed: Please respond to the NIH RFI
Transcript

cul3b-202

ID
ZDB-TSCRIPT-141209-2940
Name
cul3b-202
Previous Names
  • cul3b-001
  • ottdart00000056957
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056957 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056957|OTTDARG00000039715|ZDB-GENE-081007-1 cul3b|OTTDARP00000044692 cul3a-001 LG_ CU633805.4 Danio rerio protein_coding KNOWN, 1683 bp
TGCTCCCCGTCTTTTGTCAGAGAAGACTTTCATGTGAAAG
GGGACAACGGCGGGGAATAAGCCAGACATGTCAAATCTCA
GCAAAGGGGGCACTAAAAAAGACACCAAGATGAGGATACG
AGCCTTTCCTATGACCATGGACGAAAAGTATGTCAATAAC
ATCTGGGACCTCTTGAAGAACGCCATTCAAGAGATCCAGA
GGAAAAACAACAGTGGGCTGAGCTTCGAGGAGCTCTACAG
GAACGCCTACACCATGGTCCTGCACAAACACGGAGAGAAG
CTCTATACAGGCCTGAGGGAGGTGGTCACAGAACATCTAA
TCAACAAAGTACGTGAGGATGTGTTAAACTCCCTGAATAA
CAACTTCCTACAAACACTAAATCAGGCCTGGAATGACCAC
CAGACGGCTATGGTGATGATCAGAGACATCCTGATGTACA
TGGACCGTGTGTATGTTCAGCAGAATAATGTGGAGAACGT
GTATAATCTGGGTCTCATCATCTTCAGAGATCAGGTGGTT
CGATACGGGTGCATTCGGGACCATCTAAGACAGACTTTAC
TAGATATGATTGCCCGCGAGAGAAAAGGAGAGGTGGTGGA
TAGGGGCGCCATCCGTAATGCTTGTCAAATGCTAATGATC
TTGGGTTTGGAAGGACGTTCTGTGTATGAAGAGGACTTTG
AAGCACCGTTTTTAGAAATGTCTGCTGAATTCTTTCAGAT
GGAAAGCCAAAAGTTTTTAGCTGAGAACAGTGCGAGTGTG
TACATAAAGAAGGTGGAGGCGCGGATAAACGAGGAGATTG
AGCGGGTTATACACTGCCTGGATAAATCGACAGAGGAGCC
CATAGTGAAGGTGGTGGAGCGAGAGCTGATCTCCAAACAC
ATGAAGACCATTGTGGAGATGGAGAACTCCGGGCTGGTGC
ACATGCTCAAGAATGGAAAGACTGAAGATCTGGCTTGCAT
GTACAAGTTATTCAGCAGGGTGCCGAACGGCCTGAAGACC
ATGTGCGAGTGTATGAGCTCGTATCTGAGGGAGCAGGGCA
AAGCTCTGGTGTCTGAGGAAGGAGAAGGCAAGAACCCAGT
CGACTACATCCAGGGTCTTCTGGATCTGAAGTCACGGTTT
GACCGCTTCCTGCAGGAGTCCTTTAACAATGACCGTTTAT
TCAAGCAGACGATCGCAGGAGACTTCGAGTACTTCCTGAA
CCTGAACTCCCGCTCGCCTGAGTATCTCTCTCTCTTCATT
GATGATAAGCTGAAGAAAGGAGTGAAAGGACTGACAGAAC
AGGAGGTGGAGTCGATCCTGGATAAAGCCATGGTGCTGTT
CAGGTTTATGCAGGAGAAGGATGTGTTCGAGCGCTACTAC
AAACAGCATCTGGCCAGAAGACTCCTCACTAACAAGAGCG
TCTCTGACGACTCCGAGAAAAACATGATCTCAAAGCTGAA
AACAGAATGTGGCTGTCAGTTCACATCGAAACTGGAAGGC
ATGTTCAGGGACATGAGCATCTCCAACACAACCATGGATG
AATTTCGGCAGCACCTCACATCAACAGGGGTGTCTTTAGG
TGGTGTCGACCTCATAGTGAGGGTTCTTACCACGGGATAC
TGGCCGACCCAATCTGCAACTCCCAAGTGTAACATCCCTC
CTTCACCAAGACATGCTTTCGAGGTCTTTAGAAGGTGTTT
ATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations