Transcript

wdr4-201

ID
ZDB-TSCRIPT-141209-2781
Name
wdr4-201
Previous Names
  • ottdart00000052006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052006 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052006|OTTDARG00000036519|ZDB-GENE-060810-10 wdr4|OTTDARP00000040866 wdr4-001 LG_ FP017279.6 Danio rerio protein_coding KNOWN, 1388 bp
AAATGTGCGACTGTCAGTTCGCACGTGAACAACACTCAAC
ATGGCTGTAGTGTGTTCAAAAGCTGACTGGTTTGTTACAA
GTTGTTCTACTACTTTAGTTGCTGTAAACCTTAAGCAGTC
TAGAGAGCCTTTTGTGTTTGACTGTTCCAAAGCTGAGAAA
AAACCTAAAGAAGCTGATGTTGATAACAAAAGTGCTGGGG
AGGGATCAGAAGAGAAGGACAGTGACAGTATCCTTGCGTT
TGCCATCTCAGCATCTGGAAAGCATGTAGCGCTTACGGAT
GATCACAAACGACTTGTTCTCTTCTGCACTGAACCATCAT
GGAAGTGCATTAGTACACGGTGGGTTGTGCGGCGGTGCAC
TTCTCTTGCATTTACTCAAGCTGAGGACGAACTCTATGTG
GCAGATAAGTCTGGAGATGTGTATTCATTCTCCATTCTGG
AGCCACATAAAGCAGGAGAGCTGAAGCTGGGACATCTATC
TATGTTACTTGATGTGGCTCTTTCCCCAGATGATAAATAT
ATCATAACGGCTGACCGAGATGAGAAGATCAGAGTGAGTT
TTCGGCGTTCACCCTACAACATTCAGGCTTTCTGTCTGGG
CCACACAGAATTTGTCAGTTCATTGCTTGTGCCTGCAGGG
CATCCTGACTGGCTTCTCTCAGGTTCAGGAGATGGCACAG
TGAATGTCTGGCATTACGAGACTGGTCGCCGATTACACAG
TGTGGACATGAGGAAATTCGGGCTTGACTCAGAAAACACA
GAAAAGAGGTTTGCGGTCAGCCGGATCATCAGTTCACCAG
ATGGACAACATGTCGCTGTTCAGTGTGAGGGATTCCCCTC
AGTTCAGCTGTTCACAGTGGATTGTGGGACAGAGAGCCTC
CTGAAACCTGCAGACACGCTGACTCTTCCTCTCTCGCCAT
GGGACGTGACCTTTGACTCAGAAAACCAGCTGTGGGTTTT
GCTGGAGAGTGAAGACATGAAGGTGCTCCTGTATCGACAC
TCTGAGCAGCACTGGAGGCTGTGTGACTCTGAGAGCCCTG
AACTGAAGAAGGTCACTAATGCATTACAGACTCAATGGCA
TCTCTTTAAAGGTTCTGTGGGACTGGAAAGTCAGTTTAAA
CATCTTTATAAAGTGAACTTTGACAATATGGCTTCATACT
TACAAAAGAAACAGGAAAGACTAGACCTGGAGAATAAGAA
GAGAGCAGCAGCAGCAAATGGCTCAAAACCCAACAAAAAA
AGTAAAACCGAGAGCGGCCCTGTGCCACAAAGCACCAGCT
GAGAGGAAGTCTGCTTTTTAATTTGACATGTTTCTATAAT
ACTAATGTTGTTTTTTGTTAATTGACTGATTTTATTTTGT
TGTTCAGTAAAGACATCCAGACATGGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations