ZFIN ID: ZDB-TSCRIPT-141209-2755
Transcript Name: tbr1a-201
Previous Names: tbr1a-001, dkey-16n9.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050948|OTTDARG00000035769|ZDB-GENE-060810-93 tbr1a|OTTDARP00000040024 DKEY-16N9.3-001 LG_ CR450841.7 Danio rerio protein_coding NOVEL, 1805 bp
GACCCAGTCAAACCCAGGCTGAACTCCGACAACTTTCCCA
GTGAGTTATGCACCTGCAGCAGCAGCTCATCTCACCGGCC
AACAAACCGGTGAGTCTGGACAATGGTTTCCCGCACATCA
TCATGACCGCCGCCGCGGGGGTCGAGCGCGTCTCCTCCTC
CTGCTCCTCCGGGGACGCGCACGAGCCGCCGCTGAAAAGA
CCAAGAAGCCCGTCACCAAACGCGCGGGAGACACAGGATA
ACGGAGAGAGCGAAAACAAGCCGGAATCAAGCGACCCCCG
GACAGATTTCGCCTCGGAAATGTTCTCGTATGCGGGTCAA
CATGTGGTGCCAGCGCTCTCGGGTCACTATATGAGTCCTC
AACCGGTCATCAGCAGCGGCTTGTACAGTGGGATGAGCTA
CTCGTACCCTCAGCCGTACGAACAAACTTACGCGAACGCA
GCGGTCTATTCGTTCCCCGCGGTGTCCGGTAAAGCCCAGG
TTTATCTGTGTAACCGGGCGCTGTGGTTTAAATTCCACAG
ACACCAAACTGAAATGATCATAACTAAACAGGGCCGACGG
ATGTTTCCGTGTCTAACTTTTAATGTTTCTGGTCTTGACC
CGGCGGGTCATTATAATATTGCTGTGGATGTAATTCTGGC
GGATCCAAACCACTGGAGGTTCCAGGGCGGAAAATGGGTC
CCCTGTGGCAAAGCGGACACTAATGTTACCGGAAACCGAG
TGTACACGCACCCGGACTCTCCAAACACCGGCGCGCACTG
GATGCGTCAGGAGATCTCTTTCGGAAAACTTAAGCTGACA
AACAACAAAGGGGCTTCCAGCAACAACACTCAGATGATCG
TCCTACAGTCTCTCCATAAATATCAGCCAAGGGTTCATGT
GATTGAAATAAGCAAGAATGAAGATGAAGATACCAGCGAT
CCTGATGGAGTTCAGACGTTCACCTTTCCCGAAACGCAAT
TTATATCTGTCACAGCTTACCAGAACACAGATATAACTCA
ACTGAAAATTGATCACAATCCATTTGCCAAAGGATTTCGG
GATAATTATGATACAAAATACAGTATGGACAACACTGACC
GTCTGACACCCAGTGACTCTCCACACTCTCAGCTTCTGCC
CAGTTCAAGGTACGCAATGCCAAGCGCATTATTCCAGGAG
CAATTTGTCGACAGTTACACTAAATCCTGTTTTACGACTG
GCACTCCTGAGCGAGGACTTGAGTTTACTAACAGCATTAT
GACCTCCAACCAAACCCAAGAAAGCAGCGTGACTTCAGGC
CAGCGCTGGTTTGTATCTTCACCCTCTGTTCCATCATACG
AAGCTGATGTTGACACTGCGGCTCTGCTTTCTTACACCAC
AGCAGGGGTTAAAAATTTGCCTTTTACTAGTACTGGTGGC
TCAAGTAACAGTTTGGATTACTATACCAGCACTGCCGGAT
GGGATTCACGGGGATCGCTAGAGAACGGGAGTAAAACCAT
TTCAAATCTCTCTGGGTGGGTTTTAGATGCAACTCTTGAA
AGATCAATGCAACCGAATTACTTGCCAGATGACAGAGAAT
TGATGGAAAGATCCAGTTTAGGGGTTTCAGCGGAGCTTAG
AGGAAAAGATGTGGTGGATTCGACATGGACTGATACTCAA
TCTTCTATTAAATCAGTCGATTCGAGTGATTTAAGGATTT
TGGAAGAGGCACCAAAGGACGATTTGTCTATCCGTCCAGA
TTCAGAAGATCAGGCTGCAGAGGATGTGCAGAACAGAGCA
AGAAATGGGATCAAAGAATCAGGCTTTTTTCATTTTGACG
CTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbr1a-201 Contained in:
[BAC] DKEY-16N9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050948 (1),  Ensembl_Trans:ENSDART00000040180 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)