Transcript

tbr1a-201

ID
ZDB-TSCRIPT-141209-2755
Name
tbr1a-201
Previous Names
  • tbr1a-001
  • dkey-16n9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050948 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050948|OTTDARG00000035769|ZDB-GENE-060810-93 tbr1a|OTTDARP00000040024 DKEY-16N9.3-001 LG_ CR450841.7 Danio rerio protein_coding NOVEL, 1805 bp
GACCCAGTCAAACCCAGGCTGAACTCCGACAACTTTCCCA
GTGAGTTATGCACCTGCAGCAGCAGCTCATCTCACCGGCC
AACAAACCGGTGAGTCTGGACAATGGTTTCCCGCACATCA
TCATGACCGCCGCCGCGGGGGTCGAGCGCGTCTCCTCCTC
CTGCTCCTCCGGGGACGCGCACGAGCCGCCGCTGAAAAGA
CCAAGAAGCCCGTCACCAAACGCGCGGGAGACACAGGATA
ACGGAGAGAGCGAAAACAAGCCGGAATCAAGCGACCCCCG
GACAGATTTCGCCTCGGAAATGTTCTCGTATGCGGGTCAA
CATGTGGTGCCAGCGCTCTCGGGTCACTATATGAGTCCTC
AACCGGTCATCAGCAGCGGCTTGTACAGTGGGATGAGCTA
CTCGTACCCTCAGCCGTACGAACAAACTTACGCGAACGCA
GCGGTCTATTCGTTCCCCGCGGTGTCCGGTAAAGCCCAGG
TTTATCTGTGTAACCGGGCGCTGTGGTTTAAATTCCACAG
ACACCAAACTGAAATGATCATAACTAAACAGGGCCGACGG
ATGTTTCCGTGTCTAACTTTTAATGTTTCTGGTCTTGACC
CGGCGGGTCATTATAATATTGCTGTGGATGTAATTCTGGC
GGATCCAAACCACTGGAGGTTCCAGGGCGGAAAATGGGTC
CCCTGTGGCAAAGCGGACACTAATGTTACCGGAAACCGAG
TGTACACGCACCCGGACTCTCCAAACACCGGCGCGCACTG
GATGCGTCAGGAGATCTCTTTCGGAAAACTTAAGCTGACA
AACAACAAAGGGGCTTCCAGCAACAACACTCAGATGATCG
TCCTACAGTCTCTCCATAAATATCAGCCAAGGGTTCATGT
GATTGAAATAAGCAAGAATGAAGATGAAGATACCAGCGAT
CCTGATGGAGTTCAGACGTTCACCTTTCCCGAAACGCAAT
TTATATCTGTCACAGCTTACCAGAACACAGATATAACTCA
ACTGAAAATTGATCACAATCCATTTGCCAAAGGATTTCGG
GATAATTATGATACAAAATACAGTATGGACAACACTGACC
GTCTGACACCCAGTGACTCTCCACACTCTCAGCTTCTGCC
CAGTTCAAGGTACGCAATGCCAAGCGCATTATTCCAGGAG
CAATTTGTCGACAGTTACACTAAATCCTGTTTTACGACTG
GCACTCCTGAGCGAGGACTTGAGTTTACTAACAGCATTAT
GACCTCCAACCAAACCCAAGAAAGCAGCGTGACTTCAGGC
CAGCGCTGGTTTGTATCTTCACCCTCTGTTCCATCATACG
AAGCTGATGTTGACACTGCGGCTCTGCTTTCTTACACCAC
AGCAGGGGTTAAAAATTTGCCTTTTACTAGTACTGGTGGC
TCAAGTAACAGTTTGGATTACTATACCAGCACTGCCGGAT
GGGATTCACGGGGATCGCTAGAGAACGGGAGTAAAACCAT
TTCAAATCTCTCTGGGTGGGTTTTAGATGCAACTCTTGAA
AGATCAATGCAACCGAATTACTTGCCAGATGACAGAGAAT
TGATGGAAAGATCCAGTTTAGGGGTTTCAGCGGAGCTTAG
AGGAAAAGATGTGGTGGATTCGACATGGACTGATACTCAA
TCTTCTATTAAATCAGTCGATTCGAGTGATTTAAGGATTT
TGGAAGAGGCACCAAAGGACGATTTGTCTATCCGTCCAGA
TTCAGAAGATCAGGCTGCAGAGGATGTGCAGAACAGAGCA
AGAAATGGGATCAAAGAATCAGGCTTTTTTCATTTTGACG
CTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations