Transcript

cabp2a-002

ID
ZDB-TSCRIPT-141209-2721
Name
cabp2a-002
Previous Names
  • dkey-59p5.5-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048536 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048536|OTTDARG00000034322|ZDB-GENE-050913-25 cabp2a|no_translation DKEY-59P5.5-002 LG_ CR848663.22 Danio rerio protein_coding KNOWN, 488 bp
ATCTGTGTCTGTCCTAATAGTCTGTCTCTGCATGTCTCTT
TGAAATCTGTACTCACTACAGGACAGAGATCTACGGCCAG
AGGAAATTGAAGAGCTGAAAGAAGCTTTCCGAGAGTTTGA
CAAAGATAAAGACGGCTTCATTAGCTGTAAGGATCTGGGC
GAGTGCATGAGGACGATGGGCTACATGCCTACAGAAATGG
AGCTGATTGAACTTAGTCAGCAGATTTGTGGCGGAAGAGT
GGACTTTGAGGACTTTGTAGACCTGATGGGACCAAAGATG
CTGGCTGAAACGGCAGATATGATTGGAGTGAAAGAACTCA
GAGATGCTTTTAGAGAGTTTGACTCCAATGGTGACGGTCA
GATCAGTCTGGCTGAACTGAGGGAAGCCATGAAGAAGCTG
ATGGGAGAGCAGCTCAACCACAGAGAGATTGATGAGATCC
TCAGGGATGTGGACCTCAATGGAGACGGCCTAGTTGACTT
TGAAGGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations