ZFIN ID: ZDB-TSCRIPT-141209-2633
Transcript Name: vegfaa-201
Previous Name: vegfaa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043369 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043369|OTTDARG00000031190|ZDB-GENE-990415-273 vegfaa|OTTDARP00000034383 vegfaa-001 LG_ BX470147.17 Danio rerio protein_coding KNOWN, 2658 bp
GTTAACATCCACGGCAGTACGAACCAGCGCGAGCCAAAAC
AGTCACGGAAATAAGACGAGGAAAAAACGGACGCGTGTGC
AGCGGTCAAACCAAGGATTGCCACTGGATCACTTTACAGC
AAGCCTTTGCTCTTGATGATAATCATATGCGCAGAAGCCG
TCCTCTGGCCCTATAGACGCGCGTGCACACTGGAGGCTGC
GCTTGGAAGTGGACGAAACTTTTTGTTTGTTTTGCCTCTG
ACGTTTTGGATTCAGATTCATTAAACGTCGGCTTTCCGTT
ATACTGTGGATTTTAATTTTAAATTACGCAGAGGACCAAG
ATAGTGTGGATTTCCACTTTTCTTTATATTATAATTATTA
TTGTTATTCTTATTTATATCCTTTTTTTTTCTCTGGAGGA
GCGGGTGGCGGTCCAGAAGTTAATTTTAGCGGATTCGACG
CAGGTGCTTCGGATCTGAAGGGCAGAATGGATGTGTTACT
TTGACCCACGATATCACACTCGGTTCATTCATACCCAGCA
GCTTCGCTTTCTTAATTGTTTTGAGAGCCAGAGACTCACC
GCAACACTCCACTGGAATTACAATCATGAACTTGGTTGTT
TATTTGATACAGTTATTTCTCGCGGCTCTCCTCCATCTGT
CTGCTGTAAAGGCTGCCCACATACCCAAAGAAGGGGGAAA
GAGCAAAAATGATGTGATTCCCTTCATGGATGTGTATAAA
AAGAGTGCGTGCAAGACCCGAGAGCTGCTGGTAGACATCA
TCCAGGAGTATCCCGATGAGATCGAGCACACGTACATCCC
GTCCTGTGTGGTTCTCATGCGCTGTGCAGGATGCTGTAAT
GATGAGGCGCTCGAATGCGTCCCGACAGAGACACGAAACG
TCACTATGGAGGTGCTGCGGGTCAAGCAACGCGTATCGCA
GCATAATTTTCAGCTGAGTTTCACAGAACACACCAAGTGT
GAATGCAGGCCAAAGGCAGAAGTCAAAGCAAAGAAAGAAA
ACCACTGTGAGCCTTGCTCAGAGAGAAGGAAGCGCTTGTA
TGTGCAGGACCCCCTCACCTGTAAATGCTCCTGCAAATTC
ACACAAATGCAATGCAAGTCCAGACAACTTGAGTTAAACG
AAAGAACTTGCAGATGTGAAAAGCCAAGATGATGATCGAG
CGAACGCCGGGCAGAACTCTGCATGAAGGAAGGAACTTAA
ATAAAAACTTTTTAAACGGCACAGCACTTTCAAAACCTAA
GGAAGAACATTCCTTGGATGAACTGCAAACACTATCCTGA
ACGAAACACTAAGTGCAGGAGATATCATCCCATTGTATAT
TTTTAAGATATTAATATAAAGAATATTATATATATAAATA
TATATATTAAATGACAATGTGTGTCGCTGCTATCACCTAC
AAATAAGTCAACGAAGACGCTGCTTTCGCGTGTGAATGGG
ATATATTGCAGTGTCACTACGTCTGAGGCCTGTGATTGGA
CGAAACACAGCGAGGGATGCATAATTAAAGACTCAGCCTT
CACTGAGAGCCGACAACCTCCGGACCTTTCTTTACGAACA
GTAGCAGACTGTCAATCAAAGGACAGGAAGTGACACATTA
AAGATTCTTTTCCGGAATCTTCGGAACAGTGGGTCCAGGA
GCGGAACACGAATGCGGAACTATCTTTTTCTGTGATGTCA
CTTGCTAGGGTGAATTCGTAGTCGAAAAGACACCTGTACT
GACTAACATCCAATAGGACTTGGTGTGATAATACTAAAGG
GATATTACGTGTATGTATATATGACAAAACACACACACAA
ATCAGTGACTTTTGACATTCCACATTAAAAATACTATAGT
AAGTAGTGTTTTTGAACCATACTGTGGTAAAGTGTATTAT
ACTGACGTTTTTTTTTTGCTGCTTGTTCAAACTACTTATT
TAAAATTGAGTTGAACCAACACAATTCTTAAGTTATTTTG
GGCACAACTTAATTGTTTTATCTTTGATCCACTTAAATTT
GTAAGTTAAGTTGACTTAATCGATTTGTGTTGGGACAACA
TGAAGAAATTGTGTGGAACCCAGCCTTTTTCACAGTGTAT
ATTATAATATCAAGTACTTTACTATAGTGTATTCCAAAAG
CGACACTATAGAATTGACTATAGTATTTTGTAATGTGTGA
AGGAACGAAGTCGTTCTGTTAGTACGCGGTATTCATAAAT
ATATTTTTTTTTCCAAAGAAAGAGAATATTGCACACAACT
TTAGGAACTGTTTATTACCACACGATATCTGTATATACAT
TTCTAATATCCCTTTGTGTAGTTCGCTGCACCTAATTTAA
ATTGTTAGAGCAGTATTCTGTCTATTTAATTTGATCTATT
TATATCGTGTTATTGTTTCATGAATCTGAAAAACTGTGGA
CGGCTTTTTCTAGACAGACAAACGAGAGACAAAAACATTC
CTGAAAAGCGCCTTTTTTAGTTTGTTTATATCGGCGATCA
GCTCGGTGGAGAAGTGTTGGGATGACAAACAAACATTCTC
TTTGTGTGCCACGTTTTCAGAGTAATATATTTAATGGTGC
TGTTAACATCTTTTTTTGTGTGTGTTTTTAGTTTATTATT
ATTCCGCATATTTATTTTTAAATAATATTGTTTTGTATTA
AAGCAGAAATGGATTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vegfaa-201 Contained in:
[BAC] CH211-169N14 (1)

Genome Resources: Vega_Trans:OTTDART00000043369 (1),  Ensembl_Trans:ENSDART00000167719 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF016244 (1) 2678 nt
GenBank:BC162258 (1) 1962 nt
GenBank:BC162588 (1) 1962 nt
GenBank:AF059661 (1) 435 nt
CITATIONS (2)