Transcript

slc2a8-201

ID
ZDB-TSCRIPT-141209-2531
Name
slc2a8-201
Previous Names
  • slc2a8-001
  • slc2a8l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023397 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023397|OTTDARG00000019125|ZDB-GENE-030829-25 slc2a8|OTTDARP00000019453 slc2a8l-001 LG_ BX927256.14 Danio rerio protein_coding KNOWN, 1917 bp
ACTGAGTACAGCAGTTTTCCCAGTGAAGACGTAACACAAA
GGCTTTGATGCATCATATTTGGCAATTGTAATGTTTGATT
TAAAATCATAGTTTGTCCACGGCGACCATTTATGAACAGC
GTGGTTATCATTTGTAAGAGGAGGCGCAATGAATGAGTAT
GAAGAAAACAGACCACTGTTGGTCAATGATGAGCGAACAG
AAGAGGATAGATCCGAGCAAGACGCATACCTGGATAAAGT
TAAGAATGGAAAGCTGTTCATCGCCACCTTCGCAGCAGTT
CTGGGACCGCTTAGTTTTGGGTTCGTGCTGGGCTACAGCT
CTCCTGCTATCCCTGAACTCCGCAGAATCCAAGACCTGAG
ACTGCAGCTCAGCGTAGAGGAAGCTTCCTGGTTCGGGTCT
GTGGTGACCATTGGTGCGGCTCTTGGGGGTCTTCTGGGAG
GATGGATTGTGGAGAGGATCGGACGAAAGTTGAGCCTTAT
GTTCTGTGCAATACCATTCATCTTTGGGTTTACCACCATT
ATCGCTGCTCAGAACCACTGGATGTTCTATGTGGGCAGAG
TGCTCACTGGTTTGGCCAGTGGAGTGACCTCTCTAGTTGT
ACCACTTTACATCTCTGAAATGGCTCATGAGCGTGTTAGA
GGAACTTTGGGATCCTGTGTGCAACTAATGGTTGTGATAG
GCATTATGGGTGCTTATGTAACAGGTTTGTTCCTGGACTG
GCGATGGTTAGCAGTGGCATCATCTATTCCTCCCACACTC
ATGCTGCTGTCCATGTGCTTCATGCCGGAGACGCCACGAT
TTCTGCTCTGCCAAGGGAAACGGCGGGAAGCAGAGGACGC
CCTGCGCTTCCTTAGGGGTCCTGATGCCCCCGCCGAGTGG
GAATGCGCTAGAATAGAAGATGCCTACAAAAATGAAGAGC
AAAGCTTCAGTCTGGGGGATCTGAAGGACCCTGGTGTCTA
TAAACCTTTGGGCATTGGTGTTATGATGATGCTCCTCCAG
CAGTTTACCGGCATCAACGCCATCATGTTTTACGCAGAGA
CCATCTTCGAGCAGGCCCATTTCAAAAGCAGTGATGTGGC
CACTGTTATTGTCGCAGCCACACAGGTGGTCTTCACTGCA
ATTGCTGCTCTTATAATGGACAAGGCCGGGCGGAAAGTTC
TTCTCATTTTGTCTGGTGTCGTCATGTGTATTAGCGAAGC
AGTGTTTGGAGTGTACTTTAAGCTGACTGTGATGAAGCCC
AATAACTCCTCATTGACCAGTGTGCTAACGGACACCCATG
GTCTTCTGGAAGATCAGCCCTCTGCAGACCTGGCCTGGTT
GGCTGTGGGAAGCATGGGCTTTTTCATTGCAGGATTTGCT
ATTGGTTGGGGTCCTACTCCGTGGCTGGTGATGTCCGAGA
TCTTCCCCACGCGGGTGAGGGGATTAGGCAGTGCTCTGTG
TGTGCTTACTAACTGGACCTGTGCCTTCATTGTCACCAAA
ACCTTCCAGAACCTCATGGATGCTCTGAGCAGCGCAGGAA
CATTTTGGATGTTCTCGGCACTGTGTGCTTCTAATGTCGT
CTTCACGGCTTTCTTTGTCCCCGAGACCAAAGGCAAAACT
CTGGAGGAGATTCAAGCTGGTTTTAAAGGGACTCGCATGC
GCTAGATGACTCTTTTCCCTCAGCGCCATAACCAAAATAT
TGAACAAAACATCTTCGACATCTTGAAGAATCTTGTAATG
TTTTAGAATATTGCAATTGTTTACAGAGAAAATATCTATA
TTTTGTCTACTTTTTCTGTCATCTTAATGTGATTTATCTT
TAAATTAAGAGTTTTTAACATTACTTTTAAACACATTGTT
ACTTTTGGTACACAAACGTCATAAATTAGTGCCTCATTTT
AACTTGTTTGCAGGTCATATGAATATAAATACACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations