Transcript

sod3b-201

ID
ZDB-TSCRIPT-141209-2221
Name
sod3b-201
Previous Names
  • ottdart00000061559
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061559 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061559|OTTDARG00000042615|ZDB-GENE-030131-8743 sod3b|OTTDARP00000048132 sod3b-001 LG_ CR847546.7 Danio rerio protein_coding KNOWN, 1218 bp
GCATTATGCAAGTATAAAACAGCAACCATAAGCTTTTCAA
ACGCAAAGGACCAACAACAAAGAAACACGTTTGGCATTAA
AAATCAGTTTTTAGTGACGGAACACAAAAAGTGAAGACAT
GATACGCTTCAACATTTTACCCCTTCTGGCATTCCTGCTC
AGTTGCCATGTGCTCTTCTGTGGATCAGGCTCAGGTCTGG
CATATGCTTCAAACAGTGATTCCCTTCAGGCCGTATGCAG
AATGCAGCCTAACACTCGACTAGAGCCTGGCATGCCTCGT
GTGTATGGTCACATTTTATTCAGACAGTCTGGCCCAAAGG
AAAAGCTGAGCGTGACTTTCAGGCTCTATGGTCTCCCTGC
GGACAGTCAGCAGCCCAGAGCCATGCACATTCATGAGTAT
GGAGACTTAAGCAGGGGCTGCGACTCTACAGGTGGGCATT
ACAATCCCCTCAACGTCAACCATCCACAACATCCAGGGGA
CTTTGGCAACTTTGTGCCCGTTAACAAGAAGATTCGGCAG
TCACTGGAATCCCCTGCAACTCTCTTTGGGAAACTTTCAA
TAGTCGGCCGGTCTGTTGTCATTCATGAGGGAAAGGATGA
TTTGGGCAGAGGTGGGAATGTGGGAAGCTTGCTGAATGGC
AACGCTGGAGGGCGACTGGCATGCTGTGTTATTGGACTGA
GAAACCCCCAAAATTAATAGATATTTTTAGCAAAGACTAT
ACAGTTCATTTTTGCAGTATACAATGCTCAGCATATATGA
TTACACAAATCTCTCTTTTAAATTCATATTTTTAAAAGGA
AGCTATACAATATTATATTTGTGCATATACATTAGATTAG
TCAGTACTGAAGCCAGATCTGGAGCTTATCTAAAGTTACG
ATAGCGGTTAAAAAACTAGTACACCCAATATGTTATAGAA
AAACATTAAATATAAATTTTACAAAGAGGGAAAATCAACA
GAAGAAAAAAAAAAAGTTGGATTTATAAAAAGTTGTCATT
AATTTTTTTTGCGGTATTTATCTTGAATTTAATAGTTTTA
TCTTTTAATTTCTAAAGATGTTCTGTGTCTAAAAAAATAT
TTTAAATAATATACCTGTTTTGTTTAAATGCACCGAAATA
CTTTGCCTGTACATTAGCAAAATAACTGATGGAATGCATT
TAAATATCTAGGTATTGTGTTAAAAACACTAAATAATAAT
AAAGATTGAGGCTTTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations