Transcript

raraa-203

ID
ZDB-TSCRIPT-141209-2184
Name
raraa-203
Previous Names
  • raraa-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061443 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061443|OTTDARG00000020539|ZDB-GENE-980526-284 raraa|OTTDARP00000048121 raraa-002 LG_ BX890609.7 Danio rerio protein_coding KNOWN, 638 bp
AGAAAGAAATGCAACTTCAAAAGACTTTTTCATCGCAAGA
CAACCACAATAAGGAATATTAAAGGAAAAACCAAATGGAG
GACATCATGTCAGAACGCAAATCCCCGCCGTTGGATTCAC
TAAACACAATCAAATCTTTTCGGAAGTTAACCTGTGTGAA
ATGGAAATAAAACCCAACAGAAAACCCATGAACAGCAAAG
AAGAGCAACTCCTCCATTCATCGGTCTAGACTCCCCCATT
GTTTCTCTATCTACCGGCATCACATTAAATAAGCATCACC
TAGTCTTTTCTCTGGGCGGCCTTATGGATGAATAACCCTT
GCATATCACCCACGTCGAGTGTCGTTTTGGATTCTTCTGT
TTGACGGTGGGCGAACTGTAGAGGTGGCCATGTCTGGTAA
GGGCAACCCCAGCCCACACCTCAATGGCTTCCCAATGGCC
CACTTTTCCTATTTCTTCCCGCACATGCTGGGGGGGCTTT
CTCCACCTTCACTTCCCACTCTGCCCCTCAGTGGATACAG
CACACCTTCGCCAGCCACTATTGAGACCCAGAGTACGAGT
TCAGAAGAGATCGTCCCGAGCCCACCCTCTCCACCCCCTC
CTCCTCGCATCTACAAGCCCTGCTTTGTGTGTCAGGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations