Transcript

cap2-002

ID
ZDB-TSCRIPT-141209-1661
Name
cap2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054019 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054019|OTTDARG00000037748|ZDB-GENE-040426-1758 cap2|no_translation cap2-002 LG_none CU856142.3,CU856134.9,CU856154.5 Danio rerio protein_coding NOVEL, 615 bp
AGTTGAGTGACAGCAGGAGCCGCAGCGCCAGACCTCCTTA
ATATCCGATCCACATCTCGCTTTTTATAAAGAAAACGTGA
GAACAAAGCCCGGACCGCACCATCTGAGGAGTGTTTGTTA
TGGAGGCTCTGGTTGGTCGTCTGGAGCGGGCAGTGGTGCG
TCTGGAGGCTGTGGCTGTCAAACTGCAGAGCTGTCCTGGA
GGATTGATCAACGGAGACATCAGCGCCGTCATCAACGGAG
GTGAATCCCAGAGCATGGAGGCGTTTGACCGTCTGCTGAG
CGGCTCGGTGTCTGAATATGTGCAGTCCAGTGCTGCGATT
GGTGGAGACGTAGCGAAGCATGTAAGTCTGAGTGACTGTA
AATATCTGTCTGTGCTGATTTTACAGATGGAGGATGAGCA
GAGGCAGATAATACAGGAGTGAACTCATTCTCCTGTAAGA
GCTCTTAGTTTACAGTAGTGAAGTACGACTCAGGGCTCAC
AGCTGCTGCGAATCCGGCTTCACATTACCCTGCTATATTT
GACAATCGGCTTCTCTGGAGCCACTGGAGCTACCACAATC
CTACAGAACTGAAGCCTGGCTCACACTGAATACGTTTACA
CGGACACCTATGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations